Description :
From Genome Similarity Track
Location :
Scaffold_18:288670- 292186
Transcript NameFunction/comments
Hyaar_Emoy2900029HaRxL27

Sequence
3516 bases(100 bases per row)
GAAATAGATGGGGCATCACGAATAAGAGGTTCTTCATGCAGGATGAGCTACTGGATCGAGTGAGGATTTTTGTTTTTTACTCTAGATGATGATTCTTCGC
ATCGTAGCGCGCGCTGTTGAAAGCATCGAAATCTACGGACATCTAGTTGTATGCATATTTCGTTTCGATGCATATTTTCACACATTGCCACATGCACACA
GCACCTTTCACGTGATTGCAGCTGAATACTCGACCCAGATCAATTAGTTGTGTCTGACTCTGCCGCGGCTTGTTATCCTGTGTTTGTATGCATGAACAAC
CCACGTGCGCAAACCCAATTATCCGTCGTGCCTTCTTCGACTTTGCATGAGAGTGGTCATTCATGGAAGGCCCCACATGCTAGATTCGGTTCGCTTTATT
TTACATGCAGCAGCAATAAACCCTGTTGAGTCGAAGTGTTGTAGGACAGAGCAGAATACGTTAGATCACATGCGAAAAAAATATGTACGGTTTCATAGCC
TCTGTCTGATCTGCCTACCGTACTGACTTGATGTGTTCAGCATGCGGTAATGAGAAACAGGAGCTACATGCCGGGCGTCATCTAGAATGAAAAAGTGTAT
CCTTTGAGCAAGTACGCGCGCTATGTAGCGACCATCTGCTACAGTGAAAAGCTCGCCCCGGTGGTAATCTTTCATGTCGAAAGTGTCGCTGGAGATGCTA
TACTTGGTGGTGACTCCCAGAAGTGTTTATCACAATTCCCCACTTCCAACTACATCGCACACAGCTCAAGCTAACAGACTTCTTCATCGAACTACAACAT
GAAGCTCGTCTTCTTCGCCGCTCTTTCGATTACTTTTCTTGCGTGCAGCGATGCTGTCGCAGCTGGTGCGGAGCCTAATCAATTCGAGCCATTGTCGAAG
ACCACAGCCTCTCTTCTTCCCGCACGACCCCTCACGTTCGGCGATCTGCCCGCGGAAGACGCACGTGGAGGAAAATCGCTTCGACGCCCCGATTACAAAG
CCGATGAAGCGCCCGTCTTAACCGCTGACACCAACGAAGAGCGACTGTTTGGGACCAGTATAGGGCCAGCTGCGGAAGTGACAGGCTCTCTTATAACGCG
CATCAAGATGTGGGCTAAGAAGTTTCGTGACCGTAGTCGCATTCACCCTTCCTCCACATAGTCGGCTGTCAAAGGGAGACACGCCACTAGATACGGTAGG
CGTGTAGCGTAGACACTAAAAGGGACTAAGAGAGAGCAGTCTAGACAGAAACATAATCCATTTGAATATCAAATTGATTATGTTGCGGTACTCCGACTTC
TGCGGTTCGCACTAGTTGGTGCAGCCCATCAGCCTCGCTTATTTTTGACTCGGCAACGTCAAACTAGAGCCATGGACCGGCCTGAAAAGCAGCGCTGGAG
AGAGTGAAGCAACTAAGTTTTTGACCTGCACCCTATACCTTGGCCTCGTCGTCCTGCTTTGGGCTGGGGATTTACGCTGCAGCTTGAGCTTGAGCTCCTT
TTCGGTGTCGCTTCGTGGCGCGTGCACTTGTCTCAACGATCACGCTGGACAACACGACCAGTGTGCACTTTGTTATGCAGAAGCAACGAGCGAACAAGGC
GGAAAGTCTCGCGCGAGAAACAGCCATTTGGCAATGAACAGATGCACGTCGATCGATTTAGTGTAGTGTTGCAACTTCGAAGTCGTGTGATTGCAAGAAA
TATATCCAGCCAGATAACTAGCTCGGCACAGTCGCGAATAAAGAGTGATTGTAACCCCACTCCAACAATAACGAGGCGAATGACTTCTTTTGATCTGACG
GAGGTTGGACAATACCATACAATCGGTCGTGTTGATTGCCAATTTTCATTCCGCTTGGCTCTTCGTTTTGTCGTTAATAGGTGATATGTAAGACCAGGTG
CGGAAAAGCATCTGGCCTCCAAGAACATTATGGTCGCCCTCTCGTTGTGTCGTTGGCTAGTCAGCGAATTCTTGCCGCTGGCGGCTGGAACATGTAAACG
TGTTTTGAATAGTTGAGTCTCTAATGCTGATAGGGTCTGTCTTCGATACCAATGTGATGGAAGTAGAGTCACTAGTGAGCAGGCTGTCGATACAAGCCCG
CTTCACCTGGACGATGCTCGTAAGTGCCCATCTCGTCTTTGTCCGAGTTACAATCGGTTGCAGTGTACTAAGTGGTACCGTTTCAGCAAACGCGTTCACA
GCGTAAAGTTGGCAACGGATACGCTACTGAAGGGCGGTCAAACTGACAGGTTTTATACGAATGTATGATGTGACACGTCGCGCTTCAATTGATGCTAGAT
ATACGCATGCTGCTGCTAGAATGAGCTCAGTAACGGGTCTGTACCCAAACACCCGGATATGTCAATGGTTAACGCTCATTTTCACCTCAATCGTGTACTC
GTAAGAGACATGCTGGGCCTTTCAAGAACATACGTATTTCGATCCGAGAAGATATGGTCAATATAGAGATTGCATGTTGGTTATTCCTGTGGAGGTTGAT
TATCACACTACAAGATCCTTGGCAATCCGCACTTTGCCGAGAAATCACTTGCTTGACGTGACCGTACGATAATTTGGAGTGGTGCGTTGATCAAGCTGGA
TGAGTTCGGCGCTGACTGTCAGATTTTTCTGGCTCCTTACCTCGTGTGTCAGCCGATTCGTTCCTAATGAATATCGAGGACTGTTGTGCTGTTGTGAGCA
AACAACCCGCGACTACTCTTAAGAAAAGGTTGACACGGTACGGAGACAACTCAATTGATCGAGAAGAATGAGCTCGACTTGTTGCTCTGAAAAGAAGGAA
TATGAGACTTCCTCGACCGCCAAATTACAATTTAACGTGCTTTGCTACAAAAACTCAGTCCAAAACAATTGAGTTTGGTACTCAGTGCTCACAGCAAGAA
ATGGTCAAGGAGCGTAGCAATTACGTCCACCCCCTCTGCTGCGTAGGATGGATGAAGCTTGCATGGCTCGTGCAGTGATCCGCACGAGCCATGCAAGCTT
CATGTCACGCAACGTGACGTCTTTTGCGTTGTCCTTTGAGAAGGTGGGTACGTATAAGATGCACGGACTGCTTACCGAGTAGTCGTAGCAACTTTTTTGG
CGCTCCTACTGCAATCGGTACAGCTGATACACTTATGTGCTTAGCTCGACTTGCATCAATAGTTGCGGACCGCTTGAGCGTGTATGTAGATACACCGGAT
GATCTGTCGGCGTCTACATACTTTATCTAGAATCATTCGTATCATAACCCATCGGGTTGTATTACAATCCCTACTTGCCAGAAAGCGTGGAATCTCATTT
AATCTCCACATGATGATAGGTTCTTCACTCCAGCATCAGGGACTTACTCTGCAGCTTGCCAAATTCACATTGGCTTTCTGTGCACCCTTTCGATCAGGGA
ATAGACTGCAATGAACGCGTGATTGTTGTCGCCTGGAACCATTTGGGTGGGAAACCATATTTATAGAGCCGCGAAAAACGTGGTAGTTGTCAGAAGCACT
TTGTTGCGTCTCGATG