Description :
From Genome Similarity Track
Location :
Scaffold_72:28867- 35463
Transcript NameFunction/comments
Phyke_g3133hypothetical protein

Sequence
6596 bases(100 bases per row)
ATGATAGAGGCAAACACACTGAGGGACTGGGCTGGTGCTGGCATAAGCAAATCTCGACAAAAACATGTGTCCCTCAGCTATAACTGCCgccgacgctgct
gctggattttAGAGACGTGCGTTCACATGACGGTGGCCACATTTTAGTCTTGTCAAATGACTTCCTGTGCGTTTCGCTATGGATAATAATGCAGCTCATT
CCTCAGTTGGACGCATTGCAAGCGAAAAGCCTAGTCGCGAATTTGCACCTAAACAGCTCGGTACCTTCCACAGCACTTTGGTTTTGAGAGTTAATAGCAA
CGTATTAAAGGTACCGCTGAAAGTGCTTGGATACGCAGTAGTCGCAGGCCAACTCGCCATGAGCGGATCGCCAGGAAAACAACTTTATCAATAAATGATA
ATATCTTGATAAtagtaaaaaaaatcattCAAATATTCATTTATTAAATAACCGTTGAAATGAATTAACTTAATTACTAAACTGGCTGAAATTGCCGAGT
ACACAATAATAGAAACAATAACTATTAAAAGGCACCAATCCTACACAAATCAAACAGTGAGTTGAAGAATCGCAGCGTACAATAACGGTTTTAGCAGAAC
AAGTTGTATGTCACACTGACTTGCGATCGTGCTACAGCAAATAAAAATATCGACACGTATGAGAATCCTAGAGCGATGCTCAAAATTATCGTTGGTCGCC
TACGACGTTGACTTTTGCTAGTGGTCTGTTGAGAAGGGCGAGACCTAGCCGTCGATCAGGTCGGTTGCTCGGACGTCGTAGTTCTACCACGACAGGTTTT
CTTTTCTGTTCTTTTCTgttcttttttttcttttcttttcttgGGGAAGCATGGTGATGAGCTTAATCCGGGTGCGCACGACACTGCGCAAGCGGAAAGC
AGTTCAAAGCAGCCACCAGATTAATTGCATGAAAGAAGGTGTGCAACAGATGAGAGAGAATTGATAACAATCAGAATCGCCGCGGTACCACCAGAGTGTG
TTGAGTGCATTATTAGTAGCTATCAATATATGAATATATTAATTTCATTTCTTGTGCTGCAAAGTCATAAATGAGACTGCGGCAGACACAAGGATACTAA
CGAATCATTTAGCGTTATTGGGATATCGACGTCTAAAATTTGGTACGCAAGAAACGAACTTaataaaaacaaaatcaGAAAATCGATTTTCCATCGGGCT
AGAAATATTATTTGGAACTCAAAATATCAGTTGAAAGACGTGATTTTAAACAGAAAAAAACGAATTTAGAATTGAGACTAGACCTATTCGACGCTCCAAG
CCAAAAACTTCCACTCAACCCAAAAATAATCTCTACGATTTCATGTTTGTTTTAGGTGATGCATATTTTTATGGCAGCTCACAACTCCGTCAATTTTCAA
AACCTCGTATAGGAGAGTACCTCAAAATAAAGAGGTGTTCTTTGCTCAAATCGCGAAACGTACTCAAGTTTAATAGTATACTTATGTTCGCCGCAGTCTC
ATATAGTGTTACATGGTTCCCCAAACATTATCAATATTAACTACCCTCATAATCGCGCTACTAGCTATCCCTGTTCATGAAACATAGCCGATTTATCGTA
ATGCAACGCGCGGTGTTGCAAGCGCCACGCTATTGTATCATATTCATTACGTTGAAAGCAAGCGCCCACGCTTTGATacggctgctgcagattgtcGGTG
TTCGTTCTTTCGTTGGGACCAACGGCAGGGCTTCTCGTAACAGAGCTTCATTCAAATGCCGGCTAGCACATAGTGCTGCTCCACGACTGCGGTTCTTGTC
GGCAGCGATACATTCCAGCGCTGTGTCATCACTCGTGAGGGCATTCGAAAAGCACCATACATCCAACAGTTCGTTCTCAGCAATGATGCTGGGCATACAT
TTCGCAGGTGGTCGATACGATATGCTTGAGACAAAGAAATATCGTGGTATTCACTGTCTGGGCGACTGCCACTACAACTACAGCAGCGAGTTTGGGTTCG
GCGCTCGCCAAGAAATTGGGTTAGCGAACCTAACAAAGAGTGCGCCTGCGATGGCACATCGCTCCTGAACGAGGCGAGTTGGCGCCCAGGAAAGGCTTCT
TTCCACTGCGACAGACCAGCAGGGTTAATATCTCGATCGGACTATTCAATCGCAAGTCTTTGCTATTATCTGGCAAAGCCTTTGACTTTTGATTCTTGTA
GAGAGGTGTCACTGTCTCGGGGATGTCCTCGGTAGTCAAAGGGTTAGGTGGGCTGCAAATTCTGTGAACTTCAAGGAATTTGCAGTTCACGACTGTTTAA
ACAAAGACGACACTTCATTACATTTTTAAGTGCACTTCACAGTCAACAACATGGTCAACAACTAGGATTCTTTTGTTTCATattctgctgctctggtgtG
CAGTTAGTTATTCAGGGCCACTAACGAGCCAAGGCTTCAGGTCGTTGTCTGCGCAGCGCTCGTGAGCAAACTCAAATGTTTTCTGGGCCGTCACTTCATT
GACATGCGCCACATACCAGAGCAAAGACACTCAGCACTTCAGCACAGTCCTTGCCGTTGTAGTCTGCAACTCCATTGAACGCGATGTTCGTGGCCATATG
AAGCTGGTTAGcaagcaccttcatcagcgAGGCTAGCCGAGAACTAAAGTGACGCGACCCGGTCTGAACTCGCGGCTGATACCGAGCATCATCGTCTAGC
TCATTCCAGTCGAGTTCGGTAGTCCCTCGACAAGGGATTTGCAGCCAACTCGGATTAGGGAGACGCCCAAGACAGTGACCCTTGACTGCCTGCCAAAGGT
AAGAAAGAGTCCATCAGCACCTTTAGCTGCCTTTGGTCGCGGCGGGGCGGCATACCCTCATCATCGCCAAGCTCTATAGCAAGGTCATGGATTTTGTAGG
AAACTGTAGTTCGTAAAAAGCAGTTTCCGGCGCACCCTGTCACGGGTAAAGTGAAGGAATAAAAATGACCTTCTACATCAAAGAACACGTGTTGAAAGCC
ACGCTGATATTACTCGTGAAACGTAGTTCTATCGGGATATTTGGACCCGCTACAGAAACCCACACTTGTCGTGGCCCAGAAAGAGAGTTCTCTGTCGAGG
GACTACCGAACTCGACTGGAATGAGCTAGACGATCATGCTCGGTATCAGCCGCGAGTTCTGACCGGGTCACATCACTTTAGTTCTCGGCTAGCCCGGTTC
GGCCAAATCCGcgctgatgaaggtgcttgCTAGGGTTTACTTTCGGGGTGTGATCCTAGTTACTGCATTAAAACCatgttgttgaagtgcgAACTCATAT
TGGTGCCACCCTACAAAATCCGATACAGTGGTTGCAAATTCCTTGGAATTCACAGCCAAAATCAAGGCGACTGTATCAGATCAAGATGCATAGTAATTGC
TCTGTATTTGCCCCTGTAGGCTCTTACTGAAGCTAAAATTCAGGCATGTAGTTGACGCTCAGCTTCGTACGCAGCCATGAGCTCTACGAACTCGAGCCAT
TCAGTCTCACCTGGTTCTTCGGGACTGCCTTGCGCCAAATATTTGTTCTCGTTCTGACATATTCATACACAAAAGCATTAGGACTGAACCATTAACAGAA
TTTGTCGTCGGAAAACGCACATTTTCCTCCAGAACTGGATCCGTCGTCTGCAAACCTTTGTCGCCAAAAGTCAAGCTTGGCGCTGCTTTCTTCGAGTGTC
TCTCCATCCCTCGAACGTGGATCTTTTGCATGGCGAgaacctgctgctgggcgTGCTTTGCTTTCACGTCTGCCTTGCTCTTGGCTAGATTGAGTCTCGC
AATCTCTCTTTCCAGTTCTGTGACTTGCGTTCGCTTTATCTGTAGGTCGTTGGTGAGCCCTTGACGCACCGCTAACGTGATCTCCAAATGCTCCTTTTGC
TCTTCGAACTTTGCTTTAAGCATGgcattcttcttctctagCAGGCGAGTGGACTTGGTCAGCGTGGCCTCTAGCTGGTTAATCGTCTGGCGATCGTTTT
TCAGTTGAGTTTCTAACTGAAGAATGCGGCCTTTTCGTGATACCAGTGCCATATCGCGATCACTTTGGTGAACTGCGAGCTCACTAGCCTGCTGGTGGAT
AGCATCCAGTGCATTCTTTGTCGTCTTCACCTCGTTGTTGATATGCTCTCGTGCCTCTATCACAGACAACTGGAGCAAACGATGCAGGCCGCGGACTTCC
TGGGCGAATCGGAGAAGCTTGGACTTCTCgtcttggtgctggcgaTGACATTGCTGGAGTTTGCGATCAAATATCACGAGTTGGTCCTCTTTTTCAAGTA
ACAAAATGTTCACGCGCTCCTccagttgctggtgttggatTTCATGCCTCTGGGAGTCATCTACGATTTTTGACCGAAGTTTCAAGATTTCTATCTGCGC
GTATTCAAATTGTTCCCTTTCTTGCAACAACATGTGAAGTTCTCTATTAGTGCGGTCATGCTCAGCCTCGAATGCACAGTGTTGCGCCTCCGCAACGCCA
CGCTGTAGAACAGTGTCATTCACCTCCTTGCGCAGTCTGTCACTTTCAGCCTGAAGTTCCAGCTTTACCTTGCTTAGAGATGCGATCTCACGTTTCCACA
GCTCTGCTTCTGTTGTAAAGCGtgcttgctggagctgtagTTGAGATTCCTTTTCTTTCACGAGAACCACTTTCTCAAGTGAtatttcttcttcacgagc
AAGCAATTTAGTCTGGAAACGTTCCTTGGCATTGGCGAGTTGCTGGGCAAACAGGTCACTGGACTGTTCAGCAGCTGTGAGTTTTTGCTCCAGGTTTTGG
ATCGTCGTGCGTGCTACGACTGCCCCAGCTTCGAGTTGGGATTTCTCATTGGTAAGAACCTCCACTTGGGCTTGCAGCGATACCAAAGCTCCAGATAAAA
CGTGGGAGCTTCCAAGCATGACTGCGCTCTCGGACTCCCCTGCGTTACTATTTTCAATTGACTTGGACTTCCGGTGTTTCAGCTTGGGCATCATAGGCGG
TGCCAATGGTTTATCACCAGTGCCGCTATCTGACCCAACGGTAGCTGTCATCACAGTGGTTGTCAACTCGTGAACAAGAGAACCATCCAACCCCCCCGAA
GGACGATGCGACACTGTTTTGGACGAATCTTTTTGAGAGAAGAGTTTGGACACCGGTGTACTGATAGATAGCGAAGACTGACGTTTTACTTGTAGTCTgc
acgcagcaccagcatgaGAGAGTCGTTAGGACAAAATATCGATAACTCTAATCAGGTTAATCTCCACGAGGTTTACTTTTCGGAGAAAGCGGGAGAGCAT
GGTTTGGACGCGAGACTTTTTCTCGAGGTCTGTGTAGCAAAAACTCTGAGTAATACACGACGGTCTTGCTCACAAACAAAGATTGAAGGCACCTACAGTT
TTGCTCGATATAAGCGCTGGCTTGGGAGGTGGTGAGGCCGGGGACGCGCCGATCCGGGATGAGAAGTCTAAGCGGAAATCTGCACTTAGACTATCGGTag
caggcagcagcatttgcgtTAGAACCAACAGTACGAAGGTAGCGAGTGGAATCGTCGAACCTTTTCGATCGGCTACCTGGACTGGACGGCCGCAAGTCAT
CATCTTCTAGAAACCCAAACACCTGCTGAtcgtccaagtcgtcgaaATTAACATCGCTACTACTGGAGAACGATTCTGAGCCCGAGCCACGGCGACTCAT
TCTTGCGCAACACCTGAGCTTAGCCTGCCACTGGATTGAGGTTTCTGCCTGTGGGCTTGAGCACGAAAAGAAAAGCTACTGCTCATCGAGAAAAACGGTC
GCCGTCGGTTCACGTTGTCAGCCTAAGCCTGACCAAAGCAGCAATATCAAGTGGGCGAGCGAGGTCTGGTCAACCCGATTGATTTATTGGGTACTTTGGC
AATACATTTACTTCCTGGAGCGCTTTACGTGCTGCATGGACGGTTGGCTTGATCGTTTTGCTCGTTGACGATGGAGCTTCTGGGGGCCATCACCCACCAT
ATCGCTTACCAGAGTTTTCCGCTCGATCGCTGAGTCGTCCCAGGACGAACCGAACTGCGCCTTTCGATTCACGCGCAAAGCACCTGCAGCCACGTTGCCA
ATAAACATCTTCTCGTCTATGTCAGCGGAGCTACTTTCATGATTCTCCATTCGCCAAAACCACTCGCGAAGATCGGCGCGATCCTTGCACTTCGACACGC
AGCGAAACAGGAGCCGAAGCAAGTAGAACATGATAATGAATCCCGACAGGATGATGGCGCAAAGAATCCCCGCCTTCATGGTCGTAATAACCTCGCGAAC
GATGAGCATTTCGTTCTGTTCAGCGATAGCCAGCAGAGGCATCATGATCATAAGCACGATACAAAAAGGATGCAAGAGACATCAAGATAATCACAAGTAC
GCCTGCCACTTACCCAGAGAGCAATATTATCCCGCCGGACATCATTGAATAGCCGACCATAGTTTTGTAGCGTTTGCTCATTTGACGATAATTCCTTAGC
CATGTGATCTTTCTGTACAAGTTGGCATCAACATAAAGCAGTGTCATAACCACCTACCCATAACGTGAAGGGAATATCTAAGCATACCAGTTCTAT