Description :
From Genome Similarity Track
Location :
Scaffold_42:28865- 34828
Transcript NameFunction/comments
g17316.t1hypothetical protein
g17317.t1hypothetical protein

Sequence
5963 bases(100 bases per row)
CAATGGATCATGCGCTTCGTCCCAGCGTGGCTTTCGGACTATTCTAGGCGCGTTAATCATAGGTAATGATTCACTGACTCACTTCTCCATCTTGGTGAAG
CTTCAGCTACGGAGGCTGGATCTCTCGTGATTTGTGCATATCGTATCGGTAGGCGATGCCCGAAAGTCGTTCAGTGGCGTCAAGTCGACTGGGGTCCTCG
ATCGCTGAAATCGCTCGAGCAAAATCTACACTTTCGCTGTGGCGCCGATCCGTTCAAGACCTTCTTCAGCGTGGAACTTGGGTACAAGCTATGAGAGTGC
AGCGTATGGTCATTCGAAATGCTATTGGCAGTACCGCGTGTGCGTGGGCTGCAAATGCCTGCTATTCGACCGGAAATGCCTTTTCGCTCAAATCTGCGCG
CTGTCAAACCAGAGCCGAGCTCATTGTTGCGAATGTGCTTTGGTGCGGGATATTGTACGCAGTGACTATCGTCTTCGCTCACGTCCCAGCAATGCTGACA
CAACGGTTTATCTATCTGCCGAGGCATCGCCCGAGTGTCTTCTACTGCGTCAAAAAACTTCTTCGAGGTTCAGGTCCACGCCTAATTGCCACACTGATGA
TAATGTTGGGGGTGGGCGTAGCCGTTGCTCGGCTCTCTCGCACCGAAGGCGTCACCAAGTTCAAACTCGAGTTTTACTGCATTATCATCTGCAGTCACAT
CATGAACACGAGCGTTATACTAACAGCTCGACGGATCTACTTCCAGGAAACACACGAGGGTAAAACTCGCCTTGATCGACGGCGACAAAAGCGAAAAACT
CCCGTGATAGCAGCCGGGTTTCTCATGACCTCCAGAGTCTCTCCTATGCCGTCAGATATCGTCCCCATGTACATTTCTCCAAGTTTTTGGCGTGGGTACA
TCGGTAGTTGTTTTTCGTGCTTGCCCGTGTTTTTGGCCGGAGGCTACGTGCAGCTCTTGAGTCAGCTAAGAATTGCTGAGCAGAGTTCCATCGTCATCGT
GTGCTTCGTGACTCTCAGCACATTAGCCAAGCTGTTGGTGCAGGAAGGGGCGAAGCATTTGGTCGTGAAAAGAAGAATCCGTAGTATCCGCGTCATGTGC
ATCTTGGTTGGCGTTCCCACCGTTTTGATCGATACACAAGCGCGAATCATCCTTCTGGGGTTGCGAAATACTGGGATGGCAGCTGCTGGAACCTTTGGGA
TGGCGATTCTCGAGATATGCATTCGTGTTTGTAAGGCCTTCCTCGTCACGAATAAAATTCGTCGTCGACAAGGCTACGTGCAAGACTTGCCAAAGTTACC
AGTTCAAGTACGGCCTCAAGGTCATGATGCTAACGATTTGAGAAACTCCGTTCGGAAGTCAGTCGCAGGTGATCGAACAGCTTCGGTCGCAACCAAACAA
GTGGGTTTTGAACTCTGGAAGCACCAACGCCAGGCCTACCACACAGCGGAGCTCAATGCAGACATGTACGCCGAGTATATCGCCATCGGTTGCTCAGCAT
CCATCCTGTTCTTCTACAGCAACAACCCACACTATTCATTGCTCAGGCCGCTGGATGCATCCATGACTGACTCGGAGGCGGCAGCTCGGAAAGCAAACCA
GCTGAACATGCTTGTGCTGCAGGTCGTGGTCGAAATAATCGTGGATTACACGTCCATCGTGCTGGAGATCAGTGCTGGCATCGAATTCGATCACATCAAA
GGACTTGGCTCCTTCCTCGCCGCGCTGTTCGGGACGACTGCAGTCATCAACATTATCATTTCGGCGATTATGTTTCTGGATTGACCACTTCTCAAAGAAA
ATGTACCTGAAGTAGTTGGCTGCAACACAGTTATGATAAATACTGACTACAGTAGAAATGCCACAATATCCAAGATAAAGGCGTCTGAATTTCTTGGTTA
ACTCTCTTCTCCTTTGCTCGTGAAAACCAGCTCAGCCGTCACCAGACAGCACCCGTCAAAACAATTCAAAGTGGCAAGGCACGCTTGATACCCGTGGTGA
GTCGCTGAGCGAGCACAGAGTCACGCATAACCACAAGCAGCCGTCCCTGGCCGGTCTGCAGCTGGACCTCCAGGCCGACGAGAACGTTTTCGGCACTAGC
ATCTCCACTACGGAAGCGACCAGCGAACTTGCACTTGCCCACAACACCGTTCATGTTGTTGATTTCGTAGACTTGCGCCACGTTGCAGTCTTTCTGAACG
GCCTGAACCACAGCGTTCATCTGGACGGGGACTGGGAGAGTAAACTCGCTGGTGTGCAGAGACGCCGAATCGGTCATTGAGATACGGCGCTCGAAGTCAT
CAAGACTCATCTGCTGAGGCACAAACAGTTCGCCGACCACAGGAGAGAGGTCCACCTCGTACTTGTCTGCACTTGTGACAATTTCAAGTGGAATGTTGTC
AAGACGTCCCACGAAATCCACCTGCAGCTGAGCCATGGAAGTTGAGCCGCCAGGGAACAGCACAGGCAGTTCTGGGAACGAAACAACTTGCTGAGGGTTC
TTGCCAACCACTTGGACACGTGAGATGGGCTCGCTCGAGTTGTTTGCCAGCCACAGCTGGATAACATTCATGCCCGGCGAATGAGTTGACGGCTGGCGTA
GGAACGCGTAGTGCACATCCAACCCATTACCCGCCAGTGACGACAACAGTTCATGACGTGGAGGAGGCGTCGTAGAGGACGACACGCTCAGACTCATCAA
ATCACCCAAAAGGTTAGAGGCGGAGCCTGCCGAGGGGGCCATGGGTGCAAACGCGTGCATTGGAGGGTTGGCCGGAGTTACACCCGACGGTGACCCCAAT
AGATCGAGCGGGTCAAATGCATTTACCGGCTTCGCCTTCTTCGGCTGCGATCGTTTCTGCGACGGCTTTGTTTTCCCTCCTTTTTGCCGTCTCTGCGAGC
GACTCTCCTCCTCTGATGATTCTTCAGATTCACTTTCTTCAGCAGATGAGGCGTCGCTCTCCGATCCAGAACTTGATGAAGCCGATTCGGAGCCAGAGTC
GCTAGCTTCACTACTGCCACTTTCAGAGCTATAGTCCGATCCGCTGCCAGACTCGGACTCGGACTCGGACTCCGATTCTGAATCGGACGATTCTGAACCA
GAGCTTTCGTCACTGTAGAATCCCTTCGCTCCACCTTCTTTCTTCTTCGCAGTCTTGGAACTCTGGCGTGACGAGCCGCTACGTTTGTTGTCAATAAACG
AGGATTCGTCACGCAGGGAACGGTCCGGCTTGGCCGACCGCCACTCGGGCAGCGAGAGGTATCCAGGGACACTGTGACGCACAACATTCGACATCGTTCC
GAGCGTGAAACGAGTCTTGGTTTCGTCATCGTATCCGATTAACGGGGCGGGCTTCTTGCTCGCAAACAACTTGTGCGGGTTCACGATGCCTGCGTCTCCG
GACAATGCAGCACGAACCAAACGAGCACGATCGCGCACATCATAGTCAATGTCGAACTTGCACAGTTCGATCACATATTGGAGAAGCAGCTGAATCGTGC
GCTTCTGGGGCTCACGGAGACCAAGCTTCACCGCAAGATTCAAGAGCTGCAGACGCACTTCCGTCGACTCGTCAGAGAAATCCTTGGCAAGCAGGCGCAA
CGATTCGGCCGCGCACGTCGTTCCGTTGCCATTGTCGTTAAACTCGCCAAGCATCCAGACAATCGAAGCGCGGGCAGACGGGCTAGTCACGCGGCCAGTA
ACCATCATTGCGGCCAAAGAGCGCACAACAAGGAGGCGGTCCTTCTTGATAGCTTGCTGCTGAAGCAATTGGCGAATCACCACAACGCTCTCAGCAACGA
CTTGCTCATTTGAAGAGCGAACCAGACGCATGAGACCACTCAAGCAGCGTTCGGCCACGGGCGGCATGGCGTCTGCCACTCGTCCCAGGGCACGAACCGT
CATCGTCACGAAAGACTTGTCAACGTGGCGCACGTACGCCTGGAACTCACGCAGGATGGTACTGACGTTGTCGTTCGTCACCACGGACGTCAAAATCTCG
AGCTTGAGCTTCCGCGCATACGCAGGGTCCGTCGCGCGAACAAAGAACTCCTGCAGGAACGGTCGGAACATATCTGGGCGCGACGTCGACATCGACGAGA
TCACCGACAGCACGACGTACTGGATCTCGCGCTGGTTGCGCATAATGCGCACCAGCGACTTGCCGATCAGCGTGGACGTCGCCATGCTGTGCGTTCCACA
GTAGTAGTGCAGCGTGGCGACTGCAAGCACCACAGCGCTGTTTCTCGACTTCAGCAGCGGGATCGACGAGCGCAGCAGCAGTCGGTGGTCCTCGTCCAGC
TCCTCTCCGCCTCCAATTCCGCTCGCAAGAGCGTCGCTGCGGAACACCGACCCGATCGAGGGCAGCGTCTCTCCTCTCACACTGCCCGCTCCCAGCATGA
ACGGCGACTGACTCGACAACTTGTTCTTGTCTTGTGCGTCCTCCGACCCGCTGCCTTCATCATCGGAATAAAAACCCCTCTTGGTTTTTCTGATGGGGAA
CATCTTCTTTTTTTCCTGCTTCATCACTTGAGGAGCCTGGAACTGCTCTCGGCAGTACCTGATAAGCACGTTCAGCATCACCGTCTGCCCCCACTCGTCG
ATATCCGCCAGCAAGTGGCAGAGCTTGCGGAACGGTCGGTGCAGCAGGTCCAGTCGGTCGGGACACACCTCGTTCAGCGCCTGCACCGCGCTGCCCAGCA
CCATCGTGCTCGAGTCATTGAGCAGCGTGCCGATGATCTCCGCCAGCACGTCCTTCTGCTCGGGGTCCACGGCAAACACCTTGCTGATCGCGTTGGTCGC
GCATTTGCGTACATACGCGGAGTCGTCCGCTGCGCATTTGCGAATCGCAATCAACTGAATTTGCAGAATGTCGCGCACCCTAATGCTCGTCATGACCCTC
AGGGCGAGGGCCCTAATGAGCTGGTTCTGGTCCGCCAGGTCCTTCTGGAAGCTGTTGATGCTGAGCAGCGCCAGCTCGCGGCACTGCGAGTTGGCGTCCG
CGTAGTGCACCAGGTACATGTACACGAGCTTCTTGACTTCGACGCTGGCCACGATCACGTTCTTGACCACGTCCGCGAAGAAGGCCGACACGTCTTCTCC
CTTGGAGATGCTGGCCAGCAGCGCCTTCATGGCCTCCAGCTTCTCGGCGTGGCCCGCGACGCCCAGTTTGTTGTCCAGCAGCTTGCGGATGCGGTCCAGG
TTCATGCTCTCCTCGAAGAAGTGCGCGTCCCCCGTGATGCTCTTCATGCCGATCGCCATCGCCATCTTGATTTTGGATCCGAAAATGTCAACAAGGGAGG
GGAAAATCATGAATGATGTGGCGCACACAAGTTGAAATTTGAAAATGCACCGAAATACATTATTTTTTAACGAGAAACATCGGTGATCTGATTGTAGTGG
TAGAACTCGATCGAATTGGCAACAATAGCGATCCATTTGTCATCATAAGTGTTTGCATCTGTAAAACATTTCTCCATTTTATCCAGCTGTGACTCAGGCA
TCCGACTGCAGCAGTAAATCGTCGGTTTGGCGGGCGTCAAGAATCCAACTAATCTACTACAGGCGGACATGACAGCCATCGTCACGAAGAAATAAAAGAT
GGTCCCTCGAACAAGTTTTTTTTTCTTCAGACAGAGCCACATGCTCGGACGACGATCAGGTGCATCGATAAATCGTAGTGGTAGCATCAGCGGAACTCGG
GCAATCAATATGACGAAGCAAAAAGTAATTGTAGGCCAAATCGAGTTTGCGACGATGAGCTCACGCCTCGACAGATCCACAGAAGGTCTTCCTGCAAAAA
CGTTCCCTTGAGAATAGCAGGCATTGGTGAGCCAAGCCCACATAATGCTCCCAGTGACGTTCCTCACAGCGATCGTCTTCATTTTTAATGCATTCATCCA
CGTGGCACGTTTGTAGAAACTCGATGGCAATAAACTCCGGCGAGCGGCGGAAGTTGCAGCCGA