Description :
From Genome Similarity Track
Location :
Scaffold_5:288633- 289735
Transcript NameFunction/comments
Phyci_89680hypothetical protein

Sequence
1102 bases(100 bases per row)
TGCACAGCGCACCATGAAGCTCTTCGCGCCCCTTGCCGCCGCCTGTTGTGCACTTCTCGCGTCCAGCGTTGCCGCCGTCCAGGAAGAAACCAAGTCTCTC
GATGAACTCTACGCCGACGCTGTCGCCGAAGGAGGCAACCTCGTCATGTACCACGGCGGAGACTTCAAGTCGCAGCAGGACTCGCTGCACGAGGCCTTCA
CCACGGCCTTCCCGGAGATCAACTTCACGCTCAtcgtcgactacagcaagtaccacgacgtgcgcatcgacaaccagctggaaactgacacgctcgtgcc
cgacctcgtcgcgctgcagacgctgcaggacttccctcgttgggcgcaggagggcaagctgctcgagtacaagccggccaacttctcgcaggtctacgac
ggcttccgcgaccagcgcggcgcctatatggcttacatgatgttcactttcagcttcctgtacgacgagacggcgctggacggactcgcagcgcccagat
ccccggccgacctcgtggacccacagtgggcaggcaaaatcgcatccacctacccgaacgacgacgacgccgtgctcttcctgtacacgcgctacgtcga
gaagtacggctggaactgggtcgaggacctggccaaccagaacgtcacgttccgccgcggctccaacacggccagcgatctcgtcaccgccaaggacaag
gtcattggcgtcggcacCTACTCGGAGGGCACCCCCAACGTGACGTTCGTGACGGATGGCGGCAACGAGTACCTGGCGTGGGGCCAGCGCATCGCCATCT
TGAACAAGGCCAAGCACCCGGCGGCCGCCAAGCTCTTCATGAACTGGGCCATCTCGGAGGAGGTGCAGAAGACCGTTGTGGCCGAGAACGTGCGCGTGGA
CCTGACACCCAACAGCGGCTCCAGCCACCCGTGGGAGATCTGCAAGGCAAACGTGGACGAGTTCCCCAAGTTCATGGCGGACCGTGCCGCGGTGGAGGAG
TGGAAGCAGACGTTCACGCTGTACGTCGGCGAGGTGCAGGGCGAGCCGACGCCGGGCTTCCTCGGCGTGCACCCTGGCCTGTAAGACGCAGGCACAATGG
AG