Description :
From Genome Similarity Track
Location :
Scaffold_2314:2886- 4302
Sequence
1416 bases(100 bases per row)
TCGGAAGACTCGTCGAGGTCATGAACTAAGATGTCAGTTAGTTATGCTTAAAAGACGGCGTGCACAGCGTACACGTAGAACTCATTTGGACTATCATTCA
CGGTGCCACCCATTCATTGTGTGTATTCGGACTAACCTTTGGGTGTTATAACCTTCCCAGAGTGTGGACACTCCATTTGTGTTTTAGTAGTGTCCCCATG
CAACACTTTGGGTGACCACGCCTTTATTTTTGGTGTTTATTCTCGTCCATTAGGTGGTATTACACCCGCCTCGCGGGGGGCCCGGGGTGAGGCTTTTCAT
CGAGTCAAACAGGGTGGTTCACCGAGGCACGGATAAAAAGGTGTGTAATCGAGACTGTTTAGGCATTTGGCAACTTATCGTGGAAGATTGTCAACTGGTA
GTTCAGCAAGATACTTTGCTGAAGAGGTAGGGAGCCATTCGCAATGTGCTTTGACTCCTACGAACTCACCCGCTGCGATTCCATTGCAACCTAACATGCG
CACATCCAGATAAAACAGCGCGAGATGTCCACCGTTTCTTCCAGGAATATCATGACCCATTCAGTTCACGAGTCCTCGAATTTTGATACACTATCGACAC
CCTGCAAGTCGTTTTAGAGTTTAACCCTTCGGCGACGGCAGGTATATCCCGACACTTTATGCTGACACGGAGGTTTATCTTCACTTGAATAAAATATCGT
AATTTCGAGATGTGTGAAGGATCTCTATACCAGTAAAAAAATCCGTTGACCTCTTTGGTCCACGTCAGTCACGGAGCTGATTTCTATTGAATACTCATCG
GAGGGGAGGGAATAAACGTAGACAAATAAATTCATATTTTTACTTCGAGCTTCTCTCATCACCACCCGCTGCCAGACGTGTGTTGTCATTTGGGAAACCG
CGGACTGGAAAACGGCGACGATTTGAAGCTTGTATAAAGATTCCTGCTGTGGATATTCTTCCAGCGCGCGGCCTAGGCTATGGGTAAGTCGGTTGTTGTG
CTATTTGTGTCTGTTTGATGATTGCCACGGACTAATATTCTAGGAATGACTAACGCCAGGCAGCTCTCGCAAGACACGCAAATGGGAGTGGAATATTGTA
ACGGGGAGCAGAGTCCCATCCGGTCAGATAGAGATCTGTGCTGTTGCGCCTTCTCTGCAGAAATTTAATCATTATCACGAAGTAAGTACATCCATATATG
CAAGGTTGTATGTACACCAGTCTTACTTATCTTTTGTGGTCATGTTACAGGGAGATCGTGTGAAGAACCGAATCAGACCGTTGACAGAAGCGAGAGCGCT
AATGGTAAGCGTACAGATCGTAGTGGACGATGCCAATTGTCATCTTCGGACTCAGCCGCCTCTGCGAGTCTGAGTCGGCACATGATGCACTGTTACACGC
CACGCACGAAGGGCCA