Description :
From Genome Similarity Track
Location :
Scaffold_175:28859- 32653
Transcript NameFunction/comments
Physo_144264hypothetical protein
Physo_144265hypothetical protein

Sequence
3794 bases(100 bases per row)
CAGTCGCCACCGTCAAGGCAACAACTCCCTCCACCTCCTCACTCCTGGATTTGCCAGCTTCCGCTCAAGTCCTCCTCCACTACCGTCACCGCGACGCTCC
ACCGCTCCTCCCTCCCGTGTCATCCGTCGCTGCTCGCACCATGTCACGCAAAGGCTTCTTCACCGCAGAAGACGCGAAGGCGGCTTTCAACCTCTTCTGC
TGCGTCTACGGCATTGGAACGCTTGGTATGCCCGGTAACTTCTCGCGTGCCGGCCCCTTCATCGCGATCATCGCCATGGCCTTCATGGCCTTCGCCAACG
TCTATGGCGCGGTCGCCATTTGCCGTGTCATGCTGCTCGCCCCCACGTCCGTCAAGACCTACGGTGATCTTGGAGAGTGGGCAATGGGCAAACCCGGCCG
CTATCTGTCGGTGGTCTCGCAGATGGCCAACTGCCTGCTCGTGCCCTGCGTCTTCCTGGTGCTGGGCGGTACCTTGCTGGATGGCCTCTTCCCGGGTGCT
TTCAGCGCGACGACGTGGATCATCCTCATGGCGCTCACGTGCCTACCCGTGTGCCTGGTACCAACTCTTAAGGAAGGAGCTGGCGCTGCTTTCGCCGGCT
GCATGGGTACCATTATCACCGATGTCATCGGCGTTGCCGTAGTTATGCACGGCATGCGTGGCCACCCCAGCATTCCGAAGCCCGACCTCAACTTCAAACA
AGTTGCAGGCGCCTTCGGGAACCTGGCCCTCGCGTACGGTGCGGGCATCGTGATTCCGGCGCTGCAGCGCCAGCACAGCGATCCCACGCGCATGCCTCGT
GTGGTGGGGGTCACGATGACCTTCATTTCGGTCTTGTTCCTCATCCTGGCCAGCACGGCGTACTCGTCGATCGGTTGCCAGATCTCAGGTAATCTCCTGT
ACGCCATCTACCCGGACTCCGAGACCGGCCTGACCACCCTGGGCTTCGCCTCGGACTGGGGTATGGTCGTCCTCGCCTACCTCTTCATGCAGCTGCACAT
TACGATCGCCTTCTCCGTCATCCTGAACCCGGCGTTCTACATTGCCGAGCGTATTGTGCTCGGGATGCACAAGTCTCCCGTTGCTGACGTCGAGAACAAC
CTGCTGAATTACGCCGACGTATCCACTCCGGCCGATGTTACCGAGCGCTCAGAGAAGCAGTCGCACACGTCTCGCGCTTCAAAGCGCCGCTCCTTCATTT
CTGTGGCTGATAACGAGAACGTCCACCTCGGCGACCCGGAAGCGGAGGCTGCGGAATACCGCGGCGCCAACGCCATCAAGTACGTGATCCTTCGCGTCGT
TATGATCGCGATCCTGGTGATCGCGTCCGTGATCCTGAAGGACCACTTCCACGACTTGGCCGACTTCGCGGGCGCATCCTGCATCACGGTGAACTCGATC
ATCCTGCCCATTGTCTTCCTCGTGAAGAAGAAGTGGAACGTCATGCCCATCTGGGAGAAGGCCCCGGCGCTCACGGTGGTCGTGGTGTGCTTCTGCCTGG
GCTGCTATGTGACGTACACGTCGGGCCAGAACCTGTTCGATCCCAGCGATGACGACAGGGCCTTCCCGTTCTGTGCTCCGGAGTTTGAGAATGCCGTCTA
CTACAACTACACGGCCGAGCACGAGAGCTAGGCTAGACAAGTGCAGGTGTATGTGAAGTGTTGGGCGATTGTAACGAAACGAATCATGTTTGAACTTAAA
TTGAAGGCCTTGCCTGGTTGTGGGTTAGTACTGTACTCCTACGATTTTTTTGCTCAAACGCCGCGCTTTGTCCGTGGATGACTTTATGAGCAGTTTTGCT
TCCATGAACAGAAATTCATGAACAGTGAAACACGTCACATTTTGTAGAGACCCGATATATGGACTGTAAAACGTTCACATTTAACATGTGCAATACCATG
ATGCAATTACACTACCTAGTTCTCGTGAGCAGCCGTGTAGTTGTAGTACACAGTGTTCTCATACTCTGGAGGGCAGAATGGGAAAGACGTGTCGTCGTCG
CTGGGAGCAAACAGGTTCTTGCCCGAAATGTAGGTCACGTAGCAGCCCAGGCAGAAGCACACAACGATCACAGCCAGCGCAGGAATCTTCTCCCACATTG
GAAGCACACCCCACTTCTTTTTCAGCAAGAACACGATCGGCAAAATAATCGAGTTGACCGTGATGCATGAGGCACCAACGAAGTCCGACAGATCCGAGAA
GTGGTCCTTCAGAAGCACTGAAGCAATCACCTGGATAACGACGATCACAATACGAAGAACCACGTACTTGATGGCATTGGCGCCGCGGTATTCAGCAGCC
TCCGCCTCCGGATCACCAAAGTGCGCGTTCTCGTTGTCAGCGACAGAAATGAAAGAGCGCTTAGAAGTGCGTGACTCCTTCTCGGAGTGCTCGGCGCCAT
CGGCCGGGGTAGCAGCATCAGCGTAGCTCATCAGATTGTTCTCGACGTCAGCAACAGGAGACTTGTGCATTCCAAGCACAACGCGCTCGGCGATGTAGAA
CGCCGGGTTCACGATGACGGAGAAGGCGATCGTAATGTGCAGCTGCATGAAGAGGTAGGCGAGAACAACGGCACCCCAGTCCGAGGAGAAGCCCAGGGTG
GTGAGGCCAGTCTCCGAGTCCGGGTAGATCGACCACAGCAGGTTGCCCGAGATCTGGCAGCCAACAGACGAGTAGGCCGTGCTGGCCAGCACCAGGAAGC
AGCACGAGATGAAAGCAATGGTCACGCCCACCACACGAGGCATGCGAGTGGGGTCGCTGTGCTGGCGCTGCAGCGCCGGAATCACGATGCCCGCACCGTA
CGCGAGGGCCAGGTTGCCGAAGGCGCCTGCGACCTGCTTGAAGTTGAGGTCGGGCGAAGGCACGCTCGGATGGCCGCGCATGCCGTACATGACGACAGAG
ACACCAATGACGTCGGCAACGAGGGTGCCCATGCAACCAGCAAAGGCCGCGCCAGCTCCTTCCTTGAGAGTCGGCACCAGGCACACGGGCAACACCGTAA
GTGCCATGAGAATGATCCACGTCGATCCGCTGAAGGCACCCGGGAAGAGGCCGTCGAGCAGAGTGCCGCCCAGCACCAGGAAGACGCAAGGCACAAGCAG
GCAGTTGGCCATCTGCGAGACGACGGTCAGGTAGCGGCCGGTCGTGCCCATGCACCATTCACCGAGGTCACCGTAGGTCTTGACCGATCGAGGCGCGAGC
AGCATGACACGGCAAATGGCGACCGAGGAGTACGTATTGGCGAAGGCCATGAAGGCCATGGCGATGACCGCGATCACGGGTCCGGCACGCGAGAAGTTGC
CGGGCATACCAAGCGTTCCAATGCCGTAGACGCAGCAGAAGAGGTTGAAGGCCGCCTTGGCGTCCTCCATAGTGAAGAGGGCGCTGCGAGCCATGGTCGA
GTCCGTTTCGAGTTGGCGGCTTGAGGGGAAGGCGGGAAATTGCAGACTGAGCTTGAGTGAGGTGGGCGGTGCAATGCCTTCGTGTGCCCCAGCTCACCTA
GGACACGTAGCGGTTCAACTGGCGAAGTTCTCAGGCGATACATTTGCACAAACGGAGCGGGGGGCGTAGCCAACGCAGAACGGGTTGCAGCAGGGACCCC
TCTGTGCGCTAAAGAGTGGGCTCTATCAGTCCTCCCGGCGACGTCAGTTCCTGAGGAGCCTATGAGCGCCGGCGGATCCTTGGCCCCGCACTTTCTGGTG
CGGGATTTAACGCTCGTGCACCGGCACTCGCACCGCGACACCGGACTCTGCGCCGCCAACTGTGGCCAGCAAATCAACACTTGCCGTCTCGGAC