Description :
From Genome Similarity Track
Location :
Scaffold_47:288580- 289851
Transcript NameFunction/comments
Phyca_LT1534509548endo1 putative

Sequence
1271 bases(100 bases per row)
ggcggaggtgaagtgacactcagcccttatacagtgcggagtctgcctaagagactggagatatcgtacggagactctcgtcgtgtggctacaaaggacg
cagtcacggaatacttcaatgtggacgccagtttcacggcttacagtcagaaggcactagatagcaatgatacgcctagtgcgttactgggagacggcaa
cagcacctccagaaatgttgcagctttcgacgtactgtctgtgctgttgcagtattactatggagaggacaagaagtggatgaaggtgccgatggtgcgt
ggctcgccctacgtcacagtggagtaccagaacgtgctccctgtactggagtttaacgctacggtgttggctgtcaatggccagcaggtgcaggaaacag
accctttggctaagtggaacgagctgcagacgtggaccagtaacagatttgagctggatcttgaggtctacggagcaggagagagtgcgcacggcacggg
cagtctctgcagaagtggatcctctattttgacaaggagcgtacgctgcaactgcagttcgccaatgagaaggactaccggctgtacaattggcgtgggg
aactcaccacccctaccaacgtccgtctcgtggatacggacttttattctggagctgctcgtttggctattgttccccagggatcatctcaagctgctgt
ggatgcactagacaaggctgcagccatttaccccgtgggctcctcgattacgacggatgtcaatgctgccaccgcgtcgttctcattctgctggaagacg
aagcggttccccgatctgggagaaccgaacttgaagtcgacttcgactgctgaactcctgatgctagcgaacccgcaccatgccgcgacattcaagcctg
acagtgatgttttccaggttcttggaaagtttggacaccggacgctgaagtccaacatgaccgcagtgctcggtagctgttgggagatgcaggagacact
gcccacagcttcgttccaggaggaaaatgtgcagatccaaccgcagtatctggaggcgatcaaggttgccctggccaacgactccaactacacaccggag
gcagacgacccgtactacttcggcaaggagatcggccgtcaagctcgcttggttttaatcgcagataaacttgacgagaaggagatccgtgacgatattc
tggacaagctggaggagtggttgactccgtggatgcttggacaaaacagtgatcacttcgtgtacgaccgc