Description :
From Genome Similarity Track
Location :
contig_13:288564- 291531
Transcript NameFunction/comments
g2420.t1hypothetical protein

Sequence
2967 bases(100 bases per row)
GGGTCAAAGTACAGCGCATGCCAGCGCTGACGAATCGCAGAAACCACCTTGGTAACGAAAAACTCTTGTACCGCTTTCGTTTCGTTGAAAGGGATCGAAG
CTTGCAGCAACGAGCTACTCATCTACAGATCATAGAGTAAGTTAGCTATTCCATTGGTGTACACCCCAACATGACAGCACTTACTTTTCATAGTTGACGT
AGAGCTGAAGATCGGTAGCATCGATCAGCATACCGCACCATGAGATGCACTCAGAACCTGGTGCATTGGTTGGGAGCCTGAGTAGCTGCAAAATTCGCTT
GGCTCTTGGCAACATTGACAAAACACCCAAATTCCTCGTTGCCCTCGTGCATCACGGCGACGAACCTTCGCGCCCTCTTCAGGTCCGTCGTAATGAACAT
GAAGTCATCGGTGTACCGAAACAGCCCTTCGTGTTGACAGCAGATACTGGTACGATGGCTGGGTCGCATACCTCAGGCAATCGTTTGCCGAGTACTCGCC
GCTCGAAATGGGCATAGTACATGTTGCACAACGTGGTGGAGAGCACGGAGCCCTGCGGGATGCCGCATCGCTGAACGTAGTCACGGCCATCGACTTGGAC
GACGTTCGTAGACAAATGCTCCTTCAGCAGCTCGAGCGCTTTAGCTTTGGTCAGGTAGTCGTACAGGACACCGTCCACAAACATTGCGTTCTCTTTCTTG
GACTGCGCTGCAAGTTCTTCAAACCCCAACAATTCTCCAGACGGATATGCCGGACGCTCCAGCTTGAAGAAAAACGAAGACGAAGGCAGCGATTCATCGC
TATCTGAGATCGGAGCGACTTGGTGGCCAACCCAATGCTTGCGAATGAGATATTCATCCTCTTGTATCGCCTCTTGAGAACCTGATACAGTTTCCGAGGC
CGTATGGTATCAAAACAACGCTCCACATCGACAGTCACGCAGTAAGCCTTTGGGGTGCCCTTTGATGCACGTCGACGCTCTTCGCATCGAGAACATGAAG
AGATTTCACGGAATAGAGGCTTGATGCGCTTGTAGATTTCATCCACGTTTCGGACGGAGGCCCCAACAAATCGCTTTGGCTGGCGCTCCATCTCGAACGT
CAACACTCGGTGTATGGTTTCCATGGATCTGTTCACTGAGACTTTGCCTTGGTCCACAGCCCTAGATAAATTCATCAGCGGTCGAATACCACTCGGTTTC
GGGAGCAAGCGCAAACGAGAGGTTGCTAGCTGCCGTCTTACGGTTGGCTTGCAGGGTTTTGTCGCTTGATGGTTGAAGAATGCCTCCCTGTAGATCGTCT
AGAGCAAGTGTGCTGCAACATAACAATTCAGCGCTTAGCACTTGGCAAGTCGCACCCACAGTAGCTAGCTACCCCACCTGATCACACTCCAGACTGGACG
CTGATAGAACTCGATCTCATTCGCCACTCCTTCTGCTTCTGTAATGTAAAACAGGTTTCTCAACAATGGGAAGATCAGCGACGATATCACCCACCGCAGC
ACGTCTTCAAAAAGCTGTTGACGCTTGACTCGTTCATTTGGAGGGCTGAACATACCACAAATGAATTAGTTGTACCATTTTCAGGAATAATGAAAACCCA
ACACAGTACCAGAACTCCGCATTCGAGTTGGTATTCATCCATTCCACTCTCGTAACTTGAAACTCTTCAGCACACTGCACAACATAGTCAATACAGCTTC
TGTCTTGCATGGCTGAATTGCAGTCACGTACCTTCTTCAGCGAAAATATGTCGAACTTTCGGGAAAAAATGAGCTTGCGCAGCATCGACTTGACATACTT
CCAGTTCTTCTTTGTGTCGCTACTGCCCCACAACTCCTTAGGCACAACTCCAGCTAGCAGCTTCCGAACCAGCCGATAAATCTTCTTCTTCGGAGTCACA
AATGTCAGCATCGTCTTGATATCCTCTTTGTGCTGTTGCAGCTTTGCCACGTCTGATGTTGAGTGCGTACTGACCCGATCTCCTGGGTTGGCCACTGTCT
TCTTAGTCTTCTTCCCCACCGGCGCTGGCATGCCGTTACCAGCTTTCGATGTCCCCACAGAAGCGTGTGACAGCATTTCAATAGCTTCCTCCCTCCGCTT
ACGTTTCCGATCGCAGCTCGGAGCCACAACCTCGCTTTGGCTCGAATATCCGTCGTCAAGCGCTTTACGAACGATTGGAAGCAGGATAGGTCTCGATGTC
GCCTCTGCATCAGCATCAGCAGTTTTCTCCGCAAGCAGTCGCTTGATGTTTGGATGATCCGCCATGAACTTACGAAAACCCAGCGTGCACTGGGATTAAC
TTCCTTGCGAGCTCTTCAACTTTGAACGCCTTGAATCGTGCCACCATCTCCTGGATCGTTGGAATGAGGTTAATCAGCCGCTTGGGCAAGCGCTTTCCAC
CTGCAGTGTCTGGGAATATGGATCCGAGGACCCGTGAAGCTTCCGTCCGACTAATCGGCTCGCCTGTCTTGGACGCTTTCACTAGAGCGTGGGAGCTCGC
GAACACTCGATCCTTTCGGAAATGCCTCGCATACATCACGTGGTTGATCGACACTTCTCGCTTTAAAGTGGCAGTCGCGTCGCCCAGTCGCTTCTGTTGT
CGAAGACTCTTTCCAGTGAGCTAGCACACCACAAAGCACCACATTAGCCACCACATCCAACCCCCTTCTCAACCAGACAGCACTCTACCTGCATATACGA
CAGCGAGGCTTCCTTCAGTTGCACAACAATCGTGTAGTTCAATAGCAAGTGCGTCAGGAGGTCGTCCCCCATGAGCCGATGCAGAGATTCCCACAGCGGC
TTCTTCAGAGCAGCCACGAGAGTGTTCGGGTAGTAGCACATGACCCCATTGGACTGCGCCACTCGGTGGCCAGTAGCCCCGGGCGTCACTTCCCGATACC
CGAGGGTTAAAACGTTGGCGTCCTCCCAATTCTCCGCCCGTTTCCGAGCCAGAAGCCGCTCGATGAC