Description :
From Genome Similarity Track
Location :
Scaffold_77:28851- 39890
Transcript NameFunction/comments
Phyag_g1663hypothetical protein PHYSODRAFT_315962
Phyag_g1664pumilio-like mating protein M90
Phyag_g1665conserved hypothetical protein
Phyag_g1666conserved hypothetical protein
Phyag_g1667hypothetical protein PHYSODRAFT_315958

Sequence
11039 bases(100 bases per row)
ACAACTTTTGATATCCATCACACATCGTACTGGCATCGCGCCACTCGATAGACGGACATGAGCGACGTGCAATCGCTGAGCGactcgtcggcgtcgtccg
tGGGGCTTGGCAACTCACTCATGTgggagaaggtggcgctgtcgccgctggaggtgctgtccgtgcagctggagcacgagctgcagcacgccgaGGAGGT
AGCATcaggttctgctgctggcaagcagaacaagaatggcgtggacgtggacgccaCGACGGGCAAGGCTGCAGGTCGTGTGACGGTGGAAGTGTTGCAG
GCCAAGGACCTGGATCTGGGCAAGAACGCGGCAGTGCTAGCGGCCAGCGGCAGTTCTCAGCCGAAGCTCTTCGTGTCCACGCAGGTGACGCCAAACTCGG
CATTCGAGAAGTCCACAAAGAAGCACCTGCGAACTTCGAGCGTGCAAGCGGAGGACAATTCAACTGCGAGTTGGCAAGAGCCTCTGGTGTATGAAGGtgt
caaggccaagaagttTGGCATTAAGGCCTCGCTGAGTTGCAGCTCAGAAATTATTGCGGATGTGGTGCTTGGAGAGCTTGAGTTGCGCAGCGCCGACTTC
GAGGATCAGCTGCCGCACGAAAAGTGGTTTGACTTGAAGGCGCCGGCGTCAGCGGCAAGTATTGGTGTCACtgggaagctgctgctgcgtgttaCGTTCG
AGTACTCGGTGCGTGAACGCCACCAGCGTGAGGTGGCACTGCTCCGGCAGAAAAAGCGCGAAAACGATGACGATATTGAGCTGTACAAGACCACGGCGCG
ACAAGTGAATGCACCAGTACGACACCCTGCAGCATTTGGCAAGGAGACTGCGAAGGCTGCGCTTTATCTGCCTGGTAACAAGTTCCACATTGGTGCACAC
CACCCAGGTGCTGTCAGTGTAACACCTCTAGCGGACAAGACGCGTATTGTGACTCCGTTCGGACGAGGTGTAGTTGTGTCATTCCGGCCAGAGACCAAAA
TGTACGTCGTCCAGATCGACGCTGCATCAAAGACTATTGCTTATTTGCGCCAGAACATTGTTCACGAGGAACCGGATGAGCCGCATCTTCGTATGCACAT
GAAGGTTGAAACCCCGTACGGCATGGGTGTGCTAGAGGAGATTCGTCCCCATGACGACGTTGTTATTGTCAAGACCGCGTACGCTCAGATGTTCATGCAG
CGCAAGGACGTGAAGCTTCCAACGAAAGATATCTCCGAAATGTCGTCGAAGGACCTGATCAATGAGGCCACCAAGCTTGCTGACGCCGGCAACGAAGAGT
TCCGCGAAGGAAAGCTGCAGGATGCTGTGTATAACTATCTGCGCTCACTGGgcttcctgcagcgcgttgaGCAAGACTACGCCACTCATAAAGAAAAGGC
GACAATCATCCAGACAATGATCCGCTGTCACCTCAACATTGGCGCGTGCAAACTCAAGCTCAATGCGTACTCTGACGCCGAAATTGCCTGCACGAACGCC
TTGAGCATCCTCACGGTTCTTGCAGAGAACAAAGAAGGCAACGTGGTCTCCTGGATGGGGCGTTTGGGCTTGTCGAACCAGCTCATGTTCGAAGAGTGGC
CGGCCAAGGCGCGCTTTCGCCGCGCTCAAGCGTGCGTGAAACTAGAGAAGTACACGGACGCGAAGcatgatctgctgctggcggtgaaACTGAACCCGAG
AGATAAGACGTGCCGCACGCTTCTGGACAAGGTGAGCAAGCTCgtggacaagcagaagcgcgACGAAAAGAAGGCCTGGggcagcatcttcgacaaCCTC
GACGCGTCGGCGTCGACCATCAAAACCGCGACGACCAAAACGACGACTACCAAGACGCCAGCTGATCGTCAGAGCGAGGAGAAATCGATCTTCACACGGA
AGACAAATAAgacgacggcaacaacaacgagagCCGAAGCGGAGCCGTGGTATTTGAGCACGAGCGCGTTGGCCACCGCCTCGGTGGTGACCGCGGGCGT
GGCGGCCgttgcgctgctggcctTGAAGCCCAAGAGGTCGTAGAGGAAATCGCCGAGCGCCAAGGTTTCcccaccacttcaacttcgggTGCTGGCTCTC
TCGCTCGGCCAAGATCTGCGGTTAGAGTCTCCGCTCCTCACCTGAGGCAGAAAGCAGTCAGCAGCTGCGACTGGGACAGGGCCTCGCCACACGTGTGGAC
GCGAGCGCGCGAGGATCTTGCTTGACGCCGTATAACGCGCCCAAAATCGCGTTAGCGCCGCCGATGAGAAGCTAATACACGGTTTGGTCATTGTTGTCCA
CTGGCTGCGGGCTCCTTGCATGTGTTTAAAGCGACACGGCGGTGTGGTAAAGCGAAAGGGGCAGCGCAGTTTACCCTTTGTTGCGCGCTGCACGCACGTC
ACGCCAGTTGTTACTGCCGTCGGGTTCGATCTCCGAtcgcttcgacttcgacttcggcGGCCTGCGCCtgacggcagcagcattccGTCGCTGGCCGTCC
AGGCCTTTTATCGCCGCCTCCTTGCTGGCGTGGTTGTCACCAAGATGTGTTGTTAGGGAAATGCCACGGGACCAGCTGGCAGCGCGTGTTGTTGCCTTGC
CCCTTGGCGGAGTGATGGTCGCCGCCCCTTCTGCCCGCGCCGTGTCGACGATCCCAGGGCTGTCCCGCGCCGCTTCAACTTTGCCGTTAGCATAACGCAC
CCTTTCTTCCGCCCCCGTCGTCCACGCGAAGGAAACCCCAGGCGCGCTCGGGCTCCACTGTCGAGCCGCCGGAGATCGACACGTGCGTGCCTCGGATTTT
TCCGTGAAAGACTTAACTGCGTGTGGTGGTGAAAATTCCGCCCCGCGAGCAGACCACCGCCCCCGCCTGCCGCGCGCGGCGCCATCTACAGAGCCCGCGG
TTTCAGGGCGGTCATGTTACACACCCGCCATCTCAGACGCGCCTCGGCTTCGCGGTCGCTGAAAATTCGCGGGGGGCAAGATGGCTTTCAGCGTTGCAGG
GCAACCCTCGCGCGGGTTTCCGTCTTTTTGCAGCGCGAAACGGGCTTTTCTGTGACAGGTTGCCCACCCACGACGTAAATAACccccgcagcagcttcat
tctccaatttgcCGCCTCCTGCGCAAGTGGACGACCGCCGGCTCCGCGGCGtttcagcggcagcagctcgaccccagccagcagcgcccaTGGGCCACAG
CGACTCGATGAGCCCCGCCAAGAGCGGCGCTcccacctcctccgtctcccCCACTGCGCCGCCCGCCGGCCACGCCGGATCGCCGGgcgcggcgctggag
aagcccGTCCATCACGACAACCCCGTTGAGCCAGTGcgcgtgaagctgcaggacccCGCCGGATACCCGTCAGACTCGCTCTGGTCGGCGGAAGGACTCA
AGTCGCGctcctcgctgctcttctcggccGCGCAGGCGCTGAGCGAGCGCCCGGCGAGCTTCGCGCTGCGAGCTCCACGGCTGCAGCCCAAGGCGGGCTC
GCGCTCGGCACAGACGACGCCTCCCAGCGAGTCAGACGAGGGCGAGGCAGCGGTGGACAACCAGAAGGAAGACCAAGAGCAACGCGGTACCCCATCTGAG
AACGCCGGAGAGCTGCCGACATCATGGGGAGGAGCGACACAGAAGCTGGCGAACAAGGTACTGTATTTATTGTGCTGGCAATGGTGCAAGCTGTGGTCTC
TGACGTATTTGGTGGTCACGTGCttgccttcagcagcaagatcagCCAGCGGACAACCAGGAGTCAGAGACGCGTGGGTTGTCGCTCAACCTTGTACGTG
CTATCATTGACACCGCGTTATATTTTTGTCTAACTGTCGTGCATGGGGCCAGCAGCTACGCGACCGTGAAAATGCTCGGTCCCAAAccagcgaccaccac
cagGCAGATATCTGGACGAACCCTCACAACGACTTCGAAGACGGCGACTTCAACCCAACGGCGAGCCCCACCACGTCTCCCGACAAGCCCAACCCGCGAT
CAGCTGCAAGTTTCCCGACAACTACGGCGAGGGCCATCCCTGCAAGAACATCTCGTGGGGACAGCAACGCTGTGGGCTGCCGAGTCCCCCCCGGAATGTC
TCTCATCGATCGTATCCAAGAAGACTTCCCCCGCACACCATCGCCCGAGTACGGGCAGTTCGAGGATGGTGGTTTGGCTGCTCGCAGACCTTCGTTTGGT
GGAAGGGACCACCAGACACAGTCGATGTTCGATATCAATGAAGGAATGGGGCAGCTAAGGCTTGGCAACTATCGCTCTGCGCCGCCATACGATTCTGTCC
GCCGCCCCAGTCGCGACTTTGGAGATCTGCCTCGAATGCCGCAGCACGTCGCTGGCCCCGCCGGACTTGCTGGACTGAacggccaccgccacgctTTCGG
CCGGAGCACTAGTGAGCCACCGTTCGGTGGGTCTTACCATGGAGCCATGGCCCAAGGTTTTCCATCGTCCTACACCATGGACACTCAAGCTATGCAGGGC
TACCCGGTCATGATGGGAGCTGCCAAGCCACGTTGGGCTGCCAACGAGGACGCGTACGCATTCCAGTCGTCGCCTTTCGGCTACCCACCATCGGATTTTG
GGAGCTCACACCCTGGTCACAGCGCTAATATGCAGAGCTACCCGGTCGGCTACGCTGGAGAGTATCGCGGCATGAAGCCGACCGACAAGATGTTCAAAGT
GCGCCCGTCATACCCACTGGTTGACCACCCATTGTACGAGCGCCATGATTTTGGAGGCTACATGCCTCGCCCACAGATGATGCACAGACCCAAAGTCGGA
GGTCCTCGGCGCACTGACTTCGAGTACTTCCATTCGGTCGCCCACTCATACTCGTCCAACAGCCTCCTGGAGGAGTTCAATTCTGCGCCCAAGTCGGAGA
AATGGGGGCTGTCCTCCATCAAAGGAcacctcttcatcttcgccaagGACCAGACAGGTTCTCGATTTATTCAacagaagctggagaaggccgaCGAGCA
GTTGAAAGCTGACGCGTTCAACGAGATTTTCCCGAACTCGCTTTTGCTGATGACGGACGTGTTCGGCAACTACGTGATCCAGAAGTTCCTTGAGTATGGG
TCTctcgagcaacagcagctgctcgtcgagtTGATGACAAGCAACATGATCAGTCTGGCGCTGCAAGTGTACGGGTGCAGGGTGATTCAGCGTGCACTGG
AAGTGAcccaagttgaagagcagcttgCGCTGATCCGACAGCTCAAGGGACACGTGATGAAGTGTGTTGTTGACCAGAACGGCAaccacgtgctgcagaa
gtgcATCGAGGCAGCATCTTGGAAGAGAGCGGCTGAATGCAACGGATTGGGACCTCAAAGTTTTGTCACCGGGGAGGACATCCAGTTTATcatcgacagc
ttcgttggacacgctgcagcgctctcCACGCATTCGTACGGATGCCGCGTGATCCAGCGTGTGCTGGAACACTGCGCACCGGACCAAATTCACccgctgc
tgaacgagatcATCTTCAAGTGCCGCGAGCTTGTCAAGGACCAGTTTGGCAACTACGTTGTGCAGCATGTCATCAGCCACGGCGAGCCGGATCAGCGCAA
CATCGTCATGCAGGCGGTGCTTCCAGAGATTGCTCGCTGGAGCCAGCACAAGTACGCCAGCAATGTCGTGGAGTCCTGCTTGGAGCATGCGACGAAGGAT
GAGATCCGTCAAATCGTCGACTTTATTTTGCAGTGTGATGAGAGTGGAGCTTCCTGTGCTCTGCTCCCCATGATGAAACACATGTACGGCAACTACGTGG
TGCAGAaactgctggagcgcgcGGATGACCACGACCGCCACCGGATTGTATGTATTATTCGCCACAACGAAGACTATCTGAAGCGCTTCACATTCGGGAA
GCACGTTTTGAGTCGgctggagcgcgaggagCAGACGAACGGCTACTATTGACTGGACACCACCCCGCTACAGCACTAGCGGCTCGCAAGCAGGTGTGGC
ATCAACACAGCAGCCCTCAACATGctcctgcgcttcctgcCCGCCTACCCTACCTATATAAATATTTTTGCGCGATGGACATTCACCATGCGCCGCGTTG
AGTtcaagaccaagctgcagtgacagcaccaccaccaagaccaaAGTTTGAGCGTACGATACACGGGCCACCATACCAAAAATAATAATGACCTTCAATC
AACTGGTTCCTCTGAAGTGCAGCCTGTACTTCAGACCACTGTAGTGGTTGGTAGCATGAACACAACTATCGATAACCCTTCCAAGTGCATGGATCAATAA
ACCGTTCAAAACTCATCTATCTTGCTTCAACGTAGAAGTTGGTGCTCTAAAAGACATCTACAGCTCCTGGAGTGCCTGTGCGACTTGTGCGGATGCACGA
GTACCAGTATCCACTGCAGCGTGCACCGACATGCCAGGTTGCTCAAAAGCCGtggcttctccagcaaagAATATACGGCCGTCTACCGGAGTCGCTAGGT
CCTCGGAAGCAGTGTCCGACTGACCCACGCGTGGGAAAGCATATCCACCACGGATCCACGGTTCATCTCCAAAGTCTTTGTACATTCCCTTGACGAAGTA
CTTGTGTGCAGGAGACGGCTCGTCCACAGTGCCGTAGATCGTGTCGAGCTGGTCGAGAAAGCCCTCAATGATCTTCTCGTGCTCCACGCCCACGAAGCTC
TCAGCGTACAGGGCACCTGCAAAACCCGTGATCAGATACTGCGCTTCATTGTCGTCAGGTTTGTTGGCTTCCTGCTTAACGCACAGCTTATCTCCATTTG
GCTTCAAGTGGCCGATACCCTGCGTGCTATTAATCCAAAATTCGGGCAGGAAGCAATCCGAGCACACAACACCGTGGGTATCCTCAGGCCAAAAGCGGCC
AGACATGTGCAACAACACTTTGCCAGCGCGACGCATGTCGAACGACCCCACTGCCTCAACCTTTTCCTGCGGAAGTGCTGGAGTGTAGGCGATTTTTAAG
AATACAGCAGTAGACACGGTCACCACCAACGTACGACACAAAAGCTGCTTGCCTGAAGTGCTGGTCACCATGATGCGGTCACTCTGGGAGTAGTCCACAC
TAGCTACAGGCCAATTGAGTCGGATGTTCACGCCCTCAGCAAAATACTCAACGAAGCGCATGAAGCTAGGAACGACGCGATAGTCACCTTCGTCCTCCAA
TTCAATCCACTGCTTCTCGTAGCGACACGTGATGCGCATCGAAATATCCTCCAGCGGTCCACCGGCCGTGTTAGCGTATCCAGCTTCGCAAagcttcatc
atcgacgGAGACAGATCGACCTTGTTAAAATAATCCCTCATGGATTTCTCGGGCGGGATCTGGTCAATGTTCTCAAGATCGCTCAAGTCAGACACCGATG
AGTTAAACTTGACGAactcctcatcttcgtcgtcgtattTGAGCATGCGCTTCTGGTCGCCGATGTAATAGTAGCCGATACCTCCATCTGGGGCTGGCTC
GGTCGGACCACCATCGCCCTAAAACAAGCAATAAAATGCAATACAGCGTGAGTATAGCTGAACGAGAATGGTCACTGCTCAAATGGAAGAAAACTAACGT
GTACATTATGCATAACTTTATGGTAATGAGATGTATGAATCCAGACTGACTTCTCCCGGGTGGATACGTACAAGACTCAACGACACAAGAACTGTGCCAT
CGAATGCACGCAGatgagcagcaaaagctcGCCCTGGAGATGCTAATTAAGGAAGCATGATCTGACGTTCGCTCTTGCATTCGTATGAAGGCCAGAAGAT
TATCTCAAGCGCTCTTGCGAGCGAATCAGTGGCTGATTAATCGATGCGGCAACCTACTAGATAGACACACGTTGCATGCATAAATGGCTCTGTCTCCTCA
CCTGAGCCCAAGTGAAGATCTCGCGCAGACCGATGTTGTATTCCTCCGCAAGACGAGTCAACGTTGTGTTGGCGCCGTGCATGAACTCGGCGCCCACCTC
GATGCTCATCCCCGGGACGAAGTTCGTGTCGTTCATCACGCGGCCACCCACACGGTCCGACGCCTCCACGACCAGAACGTCCTTGACGCCCTGGACGCGG
ACGAGCTGGCTAGCGCAACGCAGACCGGCGACACCGGCGCCGATGACGACCACGTCGTGGAACTCGGGCTGTTCATCCGCCATCGCCATactgaaggtgt
tggagAATTTGAAATGGCTCCACTGCCACCGCGGCTGCACAGCCCACAGCTTGGCGGCATTTTTGTGTTGCCAAATGCGACTTGACTGGACAGCGAGTGC
TTGGTTCAAATGACTTGGGTTGAGTATTGTTGGTAATACAGTGAGGCACGATGACGAGACAGAATAATAATAATCTTAAGTTGCGTGATGAAAGAGCAAC
ATACGATGCTTGTCAAGGTTCAGCCTGCTCGACGAGAGCCATCACACGGGTGCTCGCCCAAATGGCAGCATTTCATGTATTCGCAGTCTGCTGCATACAT
GTGCATAATACACTGCCGCCATTACCCATACGCAAGTTTGGCGGCATGGTCCATGCAgatgacagcagcgattcctACCCAGCCACGTCAGCTCACAATC
ACCTTGACTTTGGTATAGGCCTGATTTCCCTGCCTATACTGATTGCATTTCCTCCACACCGATCCGCTGCAACATTCGCCATTTCCCTCTCTTGAGCTCG
AACGCTGCCACTGCATCACCATGTCTGACCTCAAGACCGAGttcgaagccgccgccgcgctcgCCAAGACCTTCACCAAGAACCCCGTACGTGCCTCGCC
CGAACTCCTTGTAGCAGTGGAAAATAGACCCACCAACTGACCAAATGCGTGTCAACACCAGAccaacgacgagaagctcgccCTGTACGCCTTCTACAAG
CAGGCCACTGTCGGAGACAACACGACGCCCGCCCCGGGCATCTTCGACCTCACGGGCAAGGCCAAGTGGAACGCCTGGAACGCAAAGAAGGGCCTGTCCA
CGGAGGACGCCATGAAGGGCTACATCGCtgaggtggagaagcagaaggccCTCTACGCTTGAAGCTCGGCTGCTAGGTCGCGTCTGTAGCTTCACTCCTC
CATCTATAGGGGAAGATGGCGATGGTCGACCCGGCATCTGCTCCGCGGCAACTGAGCCACGTTTTGAGTCGTTGACGTCTTCGTAAAATCTCATAAAAAT
GTACACGGAAACGATTATATTCTCCTCAGCAAGACTTGTAGGCTAACTGCATTCCGCTGCGCTTTGAAGTGTCTTGGATGCATGCAGAATCCGCTGAGGG
ATCGTTGGATAGATATTACCGACTGGGATATTGACAACAATGGGCCTCTCGAGGTGGCCGGCACCAACAGGAAATGAGAGAGACCCGCACAGGAAGTCGA
TTTGTGAAGCAGCGACGATCAATAGGGGACGCAGACAATGAacacgaagagaagaaccGGCGTCAACTGTTAGCGCGCCCTGCTTTCCACTTTGGCCTCG
ACTCGTGCTTCCATTAGGGCGAAGTCGGATATGAGCTTGTTGATCTGGTCTGTGTGCTGCCCAAGCTTCTTGTTGAGTGAAATTTGCTGCAccgccaatt
gctgctgggtctCCGTGTTTTGAGTCAGCAACCGCATCAGAAGCACCTCCATCGGTTCACCTGCTGTAGTTGTCCCCATGGAAAGCGGCGTTATGGCCAT
CGACGAATCCTCTTCCTCGATTCCATCCCGTTCGTGGTTATCCAGCTTTGATAAAGAGGCCGATGCCTGGCCCGAGGACGACCCTGAAACCACCGAAGAC
GtggacgatgttgaagttgatgtgGCTGGAGACACCggcatctcgatcttcttcctAAGCTCATTGTCCGAGTCCTTGACTGCGTTGTTCTCGTTCGTTT
GTTGGTTGTCGGTCATGTCAACTGCAGTTGCAATCTCTGGTAGATTTTCACCCGCTGCCAACGCTAGTCGCTCCAGAATGGAGATATCGCACGCTTCACG
GGGGCGTGTGTCcaggacgaagacgcttcCGACTGCGAAGCCTGAGTTTAGGTCGATGATCGGCGCCGCTGCGTAAAATCGTACCCCGGCAGCACCTGCT
ACAAGTGGGTTTCGTCGGAACCGAGGGTCCTGCAGCGTGTCGAGTACGACTAACGGTTCGCGGGTGTACACGGTGTAGGCGCAGAATGCGATCTTGCGCG
GGATCATCTTGTGGGCCAGGCCCACACTGGCTTTGAACCATTGACGGtgctcgtccaagaagctcaccGCAGCCATTGGACACGATAAGCGCGCCTTAGC
AAGGTCGCAGATCATGTCGAAGGGTTTCTCGGAATCAGAGTCCAATACATTTAGTGCGTACAAGGATCGCAGTCGGTCTCCTTCGTCCGCACTCACAGGG
GGTCGAGGCCACGGGTGGCCCCACTCCGATGACGGTTCGTGGCTGTGCTGGTCGAGGTGTAGGTTGGTGGTCTTTTCGGTTGCCTTAGACTCACCTTCTG
CACTAAAGTGGCCGTCCTTAATCTCAAAGGGCTGACGTGGCTTGGGCGTACGTGCACTAAGTTGCagttcgtcgctgtctgGCTCGGACACCGGACCCGA
TGCCGGCGAGTGCAAGTGGCTCTGCAACCATTGTCGAGACGCGTCCGAAGCGGCACTGAGATGTGGCGACGGTGCACCAAGCGATGGACGCGAGCGGTGG
GTGTTTGCGGTGTTGATGACACAGGACATGCACACACGAACTCGCGTGGAACCAATCGTCGCATCCACGTGAGTGTCCTTGTAGAGCGTGCAGTTTTTGC
AAACGACCTCCCCGCACTGAAGCGACAGTCAACGACAAAAGCGAGCGTAAGACATCTGAAACAATAGGCAATGCAGCCAGCAAACGGACGTACCATTCGG
CAGTGGTGTTTGCGACGGAAGGTGCCGAAAGGTCTGGTGCACACGTAGCACAGGTTGCGCTCGTGGTCGGCGACCCAGTCGGCCGAGTCCACGAGGTGCA
GCACGAAGGAGTCGTTGAGCGCTGCCATCCTGGCGGTTT