Description :
From Genome Similarity Track
Location :
Scaffold_450:2885- 5238
Sequence
2353 bases(100 bases per row)
CAAAATTGTCCAATTTGTCCAATCAGATGCCGTGAAATCACGAAATTCGCTGCGTAGATTCATCACACCCTGTTGCGATATATTCTACTCCTGTGATGGC
GGTTGATGCTAGGAGCATTGAGATAATTATGTACTATAGGCTGTGTATGAGAGCAAGATCATGCGATGTGGTATCCCCGGACTCGGTCAATTCGAACAGG
TCTAGACTTCAGTAACATCACCACTTGCCTGTTAAACCAATGAATGTGGTCATCCCTCATTCCACCATCAGTCCGTGTCGGTGCCGTACACCTCCCTACT
GGAGTAGTCACGTGGTTGTATGGGCGGGTGGCGCAAGACGTCTTGGTGTCACTCATCGCAAGTGCTGAAGCCGCCACTTCAGCACTTGCGATGGGTTCCT
ACTGTACCAAGACGTCTTGCGCCACCGCATTGGCCCACCAGAGCCGTCATGGCATTGCGACCCAACCGAGGCCACAACATAATCTTAGCTGTAAGGGAAG
AACCACATTGTATATAGTCGGAGTGACCTCATCAGAGCAGCACAATTCTCTCGAGCAGCATCACACAAAGCTCTACAAAATTCAAACAGTTCAAAATGGA
AACCTCTTCTGCCAGTATTATAGCCAATCGTGTGTATGAAGCAACGTGTGATGGACTCTGATTGGATATTAAAAAGGAGCAAGGTGGCTCACCTTGCGAA
TTCCATTAAAAAGTCAGTGGCGAATTGTAGTCTATTGAGGCTGTTGTCAGTTAATTCACTGCCGTGGATCACAACAGTAGCGGCATAGTAGAGGTCATCC
TCTTGTTGCGAGAGCCCTTTTCCAATCCCCTTGAATAGGGTAGCCCGATCGGTGAATCTGACGGATTTTCTTACCACCAACAGCAGCGCCTACGCACGAT
TTATCTCGCAAACGATCAAAGCTTCTCAAGGCACCCCACGACTTTGTCTACGTCGCCCAAGGAATATGAACGTTATGTAAAAATGCATAAATGCGTTGTA
GCTGGTGCACTTCAATGGCCGATCGTCAACATTGATGGGTACGACATCTCGTGGACAAAAGGCAAGCGGTTGCAGCGCAAGAATGCCAACGAAACCGATT
TGAACCGCAACTGGTTACAGTTCGTTCCTAACCCCAACAAAAACCCCAAACTACTGACGAAACTTACCCTGGCACGAGTCCGTTCAGTGAGCCAGAAACT
AAGGGGGATTGGGGCGAGGCTCAAGACCAAGAACATTGAACTCGCCGGTTGGGTGGACGTGCATTCCTTCGGGGGGGGGGGGTAGATCTTGTAACTATAC
ACAATTAATTGTGTGCAATTAATGACGCATGAAACTAAGCCAATCGCTGCTCCCTAAATCGGAAAAGCACCAATCACAGAACAACCTCTGAATATGTATA
CTCGTAGCCATACAACACCGAAGGCTAAAATAATATCATCAACAATTGGCACATCACTTTATAGAGGTATAGCATATATGAAGAGATGTATACAGCTCAA
TTGTGCGAAATGCATTGCACGTTGATAATTGGTGGATTGCCCTGAAAATTGTCTACAATTTAGGGCACTTCAGGTTTCAAAAAGGATGCCTCAATCAGGA
ATTATGGCCATTCTCTGAAAAGCAAAAAAAGCTGTGTTGCAACAATTGGCATTCTACGTTACCGTTATGGCGACACAACGCAATCCATTGGCAACGGTGA
AGACGAAAAGTTTGAACGGCTCAGCAACGGAGGCGCGTACACGGGTCAGACGGTGGCTTCCTTTGACCCTGTCTTCGGGGCATTCGACGACTACCTCTAC
CTCACGTACCAGAAGCCCGTTTTGACCATCGAAGTGGCTGGTTCTGATTTCGTTGCCCCCGTGTCGACCATCCGTACCCGCGGCAAGGAAATCTTTAAAG
CGTTGACTCAATTTGCCGTGGAAGTCCAGAACTTTGACGTCAACAATTCAGCCTGTTAAAGCAGTTGCGTCACCACCTATCCCCGTAGTAACCCTAATTC
CCTCCTCATTGAATCAAAAATTTCAAAATCCTCATCCCCAACTTTTCCCAGCCATCCGATATGTTCACGACCATCCATACATCCTCTCGAGTACACACAA
ACCTCGCCATTAACAGCGATCCTAAACAGCTAGACAGAACCGCTCGTTCCCCCCTCAAACGAGTCGGCGTTCGTACAACGGTGGAGAATTACACTAACTC
CAAGTATTTCATTATTACGAAGGGCGGGTCTGGATGCCACCAAAAGGGGCATAAAATGACCGTTTGTCCAAGAAAAGTATTGCGCTTTTCAACATTTCTG
ACAGTGATTTTAACACCTTTAAGGATTGAACGCATTATACAAAGCAAGGTTGC