Description :
From Genome Similarity Track
Location :
Scaffold_134:28843- 30893
Transcript NameFunction/comments
Pytap_DAOMBR444snap_masked-pag1_scaffold_134-abinit-gene-0.59Transient receptor potential Ca2 channel (TRP-CC) family protein

Sequence
2050 bases(100 bases per row)
cCTCGTCTACTTCGTGCTGGATGAGggcTCACGCTTGCccctCaCtGCGGAGTGCCACcGCGAATTCACcTTTGCcGAGTTGgCGTTCTTGTATGCGACG
CTACtGCTaGTGGGCTaTCTTGtGGTGGCAGCTCACTTtGTTCTGCCGTTtCTTGGTGCATCTCAAGCTtCAAGCTGACGCGGCAAATGACGCCAACCAC
ACATCGGCTGTCAGCGAtCGGTTTCGcTTCCCCGATCACTCGAtCTTtGtATGGTCAGACCGACGCAGGAAGATTAAGCGGTTCAAGAAGCTTCTATATC
GTGCTGCGGCACGTGGCGACGCAACGGCCGTCGACTCTCTCCTTGAAGAGGACTCATTGACTCAGTATGGTGTCTCCAACGCCAGTAGCCTGTACACCAC
CAAGCCGACAATGTGGCTATATGCGTTCGCCGCATCCaCCAAAAATCCCCTTCATATTGCGGCCAAGCGCGGCCACGAGCGTATCGTCCGACGCCTTCTG
TCTGCCGGTTTCGATGCCAACTCTCTGGACAAAGTAGCTCGCGTCAATTTCAACCTCGGCCTCCTCTTCAAAACTGTCACGCGTGCATTTATTAAGACCC
AAGACGGGATCAAGTCTCCCCTTCGCGCCGTGCTCTGTTCCGTTTTGCTTCCCCCTCTTCACGGTGCGGTGGCTGCTGGTCACGTTGACGTTGTTCGACT
CCTGCTCGAAGACGGCGATGCCGATCCAAACCTACTCCCCCGGGCGTCGTTTTACTATCGTTCGGCGGTTCTTCCAGCTATCTTTCTTGCGGATGACCCT
CAGATTGCCCAACTCTTGATTGCAAAGGGTGCGAACTTCCTTCATGTGGCGTTCACGGCTTCCCAATCCGGTCTTGCTGCAACCACGTAcGCGACCCCTC
TACAaCGTAGTGCACTGACCCAGCGTACGGCCACTACCGAGTATCTGCTCTCATGTGGTGCTGATGTTGCACTCACTCCGTTGCATGAGGCTGCTGCTGC
TGATAATGTTCGCAAAGTGAAGCGTCTTCTCACTAGCCGTCGCCTCCCGAACGGATCAGCTAACAGTGGCGTTGACACACTCGGCGAAAGAGTTGAGGGT
GTTCAGCGGCGTACCCCACTTCATTGGGCTGCTATCATCGGACGCGTATCTTCTGCAACAGTGCTTCTCGAGCGTGGTGCTGACCCCAACGCCCGAGATC
GGTACGGCCGGACGCCGCtCcATTGGGCAGCGCGGAATAATCATGCTGAGGTTGTTGAGCTTCTTCTCAGTCACGGAGCAAACGCTAGCGCTGAAGATGA
CGGGGGAgTGCCAGTTTTAtCGTTCGCGGCGGAGGCGGACGGAGTCGAAGCTAGAGTCGTTACAGCTCTGCTGTCTCACGGCGCATCGCTCAAGCATCAA
CTAGGAGGCTCTGGCGACACAGCCCTTCATATTGCACTCCTTCGTGAAAATCGCGCGACGGCCCTCGCTCTGATTCGCTGTGGGGCGAGTCTTCTCGCCA
TCAACAGCGAAGGTAAACGCGCTGTGGACGTCACTAGTTCCACACAGCTCCAGTTTGCGCTCAAGAAAGAGGCCGGGACTCGAGACATCATGTTGTCATA
CCCTCActCGCATTTTACGTTTGTGTCCACTAAGGTCCGCGAATATTTGGAGTCGCACGGCAAGCTCACGTGCTGGATGGACACAATGGACCCAAGTGGT
ATCGGTGGTGGTGCTGTGTGGCGCGAGGAGATTGCTCGCGGCATCCACAACTGCTCCCTGGTGTTGAGTGTTGTTTGCAAAGGATATGCCCAGTCTGAAT
GGTGTCTGAAGGAGCTAGCGTTCGCCAAGATGATCAGGAAACCCGTTATTGCGTTGATGGTTGAGTGTGACGAACAAGACGAGCAAGCCCTCGATGGTCT
CGTTCCGATAGCATGTCGCATCCCATTCAACTCTTTCATTCTCCAGAAACGCGTCTCTCTCAAACCCTCTCGACGAGTCGAGTTCACTGTTGATGATGAG
GCCctcGAAGCTGCATGGGTCgATGTCCTTCCCAAGTTGAAGAGTATTAT