Description :
From Genome Similarity Track
Location :
Scaffold_196:28841- 30830
Transcript NameFunction/comments
Phypl_g5089hypothetical protein PHYSODRAFT_555469

Sequence
1989 bases(100 bases per row)
CGTGGAGAATCTGGACGCGCTCACGCACCTGCACGAACCTGCGTTTGTGGACTACTTGGCACAGCGCTACGGCGTGGACCAGGTCTACTGCAGGTCCGGG
GCCGTGCTCATCGCTGTGAACCcgttcaaggagatcgcgGGGCTTTATGATCTAACCAAATTCCACGAAGAGATGCCGGGCTGGTCGGCACTGCCGCCTC
ACGTGTTCTCCATTGCGGAGGGGGCCTATCGGTCCCTTCGAAGACGACTGCACGAGCCTGGAGAGAGCAAGCAGAACCAGACGATCCTGGTCAGTGGAGA
GAGTGGAGCAGGCAAGACGGAGACCACAAAGTTTATCATGCAATATTTAGCAGAGAGCAGTCGGGATACAACTGCAACGACGGGCACTACGAGGAAACGA
GCGATCAGCGGCAGTGAGTTGATGAGCGCGAACCCGATCTTGGAGTGCTTTGGCAATGCCAGGACGCTGCGGAACGACAATAGCAGTCGGTTCGGAAAGT
TTGTGCGTATGTTTTTCGAGGGGCATGAGCTGGACGCGTCGTTGAGGATGGTGGGAACTTCCGTGGAGACGTATCTGTTGGAAAAGGTGCGTGTGGTGCA
CCAGAACGACGGAGAACGGAACTTCCACGTGTTTtatgagctgctggctggtGCAGATGAGGAtatgaagaaggagctgcatCTTGAAAATCTGTCGGCT
CGAGAGTTCCAGTACGTTAATGGTGGACAGTGCTTCCAGAGGAATGATGGTGTACGTGATGACAAGCAGTTCcagttggtgctgcagtcgatgaAAGTGC
TGGGTTTTACGGACGTTGAGCAAGAAGCGATCTGGAAAATATTgagtgcgctgctgcatctcggaAACGTGTTGTTTGTTTCCTCGagcgaagatgaagg
agaagaagacaatGGGACAGCATCGACACCATGTCGACTGGCATCCAcctcgctgtcttcactTACAGTGCAGGAACATCTTGATATCGTGTCAAAACTG
TTTGCTGTGGATCAGGAAGAACTGGTGTCCGCGCTGACTACGCGAAAAATAAGTGTTGGTGGCGAGACATTCCATACAAATTTGAGCCTTGCGCAATGTG
GAGATGCCCGAGATGCTATGGCGCGCTCACTATACGCATTTTTGTTCCAATTTTTGGTCTCGAAAGTCAACTCCGCCTCGCCACAGGTTCAACAGACTAC
GAACCTAGTCAGTAAGCCAGCAAGTAAGGATGCCGCGGCAGCACCATGCATCGCAGTTCTGGATATCTTCGGGTTCGAAGAGTTCGACGTCAATCAGTTC
GAGCAGTTCTGTATCAATTACGCGAACGAAAAGTTGCAGTACCAGTTTATACAGGACATTCTTTTGACGGAACAGCAGGCGCATATCGAGGAGGGGATCA
AATGGAATGCTGTGGACTACGAAGACAACTCCACGTGCTTGGAAATGGTAGAACAGCGTCCCAGCGGTATTTTCTCGCTTCTGGATGAGGAGTGTGTTGT
TCCGAAGGGGAGCGATGCAGGTTTTGCACGGAAACTGTATCAACGACTGCAAGAccacagcaacttcagcGCCTCTCGAATTGAGCAGGCCGACTTTGCT
TTCCAAGTCCATCACTATGCGGGTAATGTTCGATACCAAGCAGAAGGCTTCTGTGAGAAGAACAAGGATCAGCCCAATGCAGAGCTGTTTAGCGTTTTGG
GTAAAACTAGTGACTCGCATTTGCGCCAGTTGTTCGAGTTTTTTAAAGCAAGCGAGTTGGCACAATTGCAACTTGGGCAGCCTAAGCTGAGGCGACGATC
TTCAATACTCAGTGCTGTCGGCATCGGCTCTcagttcaagcagcagctagcAAGCTTGCTTGATGTCGTagagcagacgcagacaCACTACATCCGTTGC
ATCAAGCCTAACGATGAGAGCGCAAGTGACCAGTTTGACATGGCTAAGGTGTCAAGTCAATTGCGCTACGGTGGCGTGCTGAAAGCTGT