Description :
From Genome Similarity Track
Location :
Scaffold_501:2884- 6930
Transcript NameFunction/comments
Hyaar_Emoy2814235reverse transcriptase

Sequence
4046 bases(100 bases per row)
TCGTGCGATTGCATCACATCAAAACGATTCTTGCTCACCTGATCGCAATCGAACTCTTACAGCATAGCTCGAAAATTTAGATCAGCTTCGTCAATTGGGT
CACTGTACTCCTTCCATTGTACCAGGTACTGCTTGTGTATTCGGCCATATCTCGTCTTCCGTCCTGATCGCACATCGATGATCTTGTCTACTTCAACTCT
TCCGCGTCGAGATTACCCTCCCAACTATCTTCCGGCAGCAGTGCTTTATCAAAATCAAACCGAATTGCCTCATCCGCATTTAATCCACCCGTTGGGCGTT
CTGGGAATATGCGAACTAGCTTCAGCTTAGACACGTGGAATATTGGGAATAGCCGGTACGGCGTGCCGGCGATGTCCAACTTTACGGCGTGATCGCCACA
CTTCTCGGCCACTCGAAAAGGCCCATGCCACATATGGGCTAGCTTTCGAGCATATCCTTCCTTGACTCGGTCTAGATATAGCCAAACTCGCGACCCGCGA
TCGGTATCCAATAAATATCGATCTTCATTATGTCGATCGGCTCGACCTCTGATCGCAACCTTCAGTCGTTCATTCACTACCGCCCGAGCACGTTGATATT
GGCGTTGCATACCATATCTCCATTTTCGGGCATCTCGATCCCGGGGTTTGGTACTTCCCAACGGTAAGGTTGCTTCCAAAGTCGATCTTGGGTCCTAATC
GTGAATCAGGTAGAACGGTGTATGTCCTCGAATTCTATCATGAGCGGTTTTGATCGCATAAGTCAATCGCGCTGCGTATTCGTCCCAGTCCTTTTGATTT
TCATCCATGACATACATCTTGATCGATCGAGTCAGCGTCTGTACCATGCGTTCAGCCGTACCATTAGCTTGCGGTCTATACGCCATAGTGGCCCGTTATT
TTTGTCCCGCGATCCGATTGAATGCTCGGAAGAAATCAGACATAAATCCCGGCTCGCGATCATGTCGTATCGCCTCACTCGCAACGAATCGTCTGAACAC
GCACTCCTCGTAATTCTCTGCGATCGACTGGGCAGATCTGGACGAGCTTGCCTTTGCGATCACATATCCTGAGAAAAAATCTACCCACAGCAACAGTTCG
GTGTTTCCTTTAAAGGATCTTGGCAACGAAGGGATGTTATCCATAGCTATAATCTGAAAAGGGTACGTCGATTGCATATTACCAGGTGATCCACTTCGAT
CCCCCGGCCGTCCTTTTCCCGTTTCACAATCTACACATTCTCCCACATGCTGCTGCACACTTCGGTACAACCCACGCCAATGGAAATTCGCCCTGATCCG
TTGATAGGTACGGCATATTCCTTGGTGACCACCCTCCAAACTTGTGTGGTAGTGGTGCAAGAAGTCTCGCTGTAACTGTTCTGGAACCACCAAACGAGCC
AGTTCAGTACGATCTTCAGCTTCGGTGGCCGATCTCGGACAGAAGAATAGCAGCCCACTTTGGTCTAATTTATAGTCCGGTGCGATCAGGGTGCACACCT
TATCCTCAGCTGCCGAAAATTTAGCTACGTCTCCAACCAGATATATCTTCAAACTAGATATCCAGTTTTCTTCGTCTTGTGCTTGCTTAATACGACCAAT
CCGTATCTGCTGCACAACCTCTTCCTTTAAACCCTGGGCTGACAACGTCTTCTCTGGGCTGTTCGAGTGATAGCCGCTAGTTTGATCGCACGATCAACTC
GTTCTGGTAGTAGTAATTCGTTTAACCGATTGAGAGTAATCAGGTCCTGACGCTCTTGATAGGAAACCACAACTGTCCCTTTTTCTTGCCGCAGAGCTTC
ACTCTCCAATCGATCTGCACTCTGATTCTAGTCCCGCTTCATGTGCAAGAACTCGTGGGATGGCCACGATCGTAATCTCTCCATAGCCCTATGCCTCAGC
AACTGCAGTCCCGGCGATTTACAGTCGATTTCTCCTCGCATTTGACGGATCACCAAATTCGAATCTCCGCAGATAATCACCCGTCCCCTTGCCTGATCGG
CAAGCAAATCGAAACTAAGGAGCAGCCCTCGGTATTCTGATTCATTCATGGTTAGATCAGGGGTATACTCGGAAGCAACAGCCACAATCGTCCATTTCGG
CACTTTTCCATGTACTCGCGCTGTATGCTCCGTCCTTTCTTTTCACCCTGGCTGATCCATCGAAACTGGCTACCAGCATGTTTTCATTCACACCTACTGT
GGGTGGTGACATGCTTATCGTCTGTCTTGGCTGCTTCCTCGGGGCGATCGCAATCAATACTTCATCTACTTCTTCACGAGGTGTTATACTTGCCGCAAGC
ATGCCGAGTATTTCATCTTCTCCCTTCTCAAATCGCCTAATTTCCAACGTCCAGTTCGATAGTAAAGCAGCTCATCTTCCCAATCTTTCGTTGTGGCTTG
AAGATTGTAGTAACCATGCTAGTGTCTAATATCGCGTAAGCACCGTAATCTCACGGGATACTAGCATAGTATAGCAGATGTCTAGCATCCGGAGGAGAGC
CAACACTTCTTTCTCCACCGCCCCGTAGTTGACTTCGTTGGGCCTTAGCATACGACTAGAGAAAGTGACAGGCCAATACACACTATCATATTCTTGAAGC
AGAGCAGCTGATACAGCCCACTTACTAGCATACACCACGATTACAGGCGATCGATCGGGATCGAAATGCTTTAAGATTGGAGTTGTGGCTATCTTAGTCT
TTAGCAACGTGAATGCAATCATTGCCTTCTCCCATCGATTCCTGCCCTCCGGATCGCGATCGTCCCCTGCAATTGGGTATAGATCGACATTGATCTCCGG
TTTTGGGTACAGATCACGATCGCCCCCTGCACTCCTTTCGTGAATAGCATCCGGTCTTACAGCAGAGGTCGGTTTTGGAGCTTCACTCACGCGGTTGATC
TCATGGAAATCTGCTTCACGCAGTTTGTACAACACTGATGCGTAAACTGCGAAGTCTTCAATGAATCTACTGTAATAGTTGAGACTTCCCAAAAATGACT
GCATCGCTGGCAGCGTCCGAGGGAACGGGATGTTCACCAACGATCCCAGATCGTTCCGGTTAGCTTCCAAACTAGCGAGCGATATTTGATGTCCCAGATA
TTCAACCCTGCAACGTCCTCAAAAACGTTTGGCCAAACTGATCGACAAATTCCACTTATCGCACACCTCCAATAATCTCTCCGCTTTCTCATACAGGGCC
TTCCACAACGTAGCTGGTATTAAAATGTCATCAATACAAGATCTTCGACCCAACACTGATGGTTTTGGATCAGTATCTGGTTCACCATCAGTGAAGACAT
TGATCAACTTCGGCGATTCCGCCGTGGTCGATTCGGATTTTACGCCGATTTTCAAATACCCATACAGAGCGTTATCGATCAAACGTTGGTAGATCTGTGG
AGCATTTTTCAACCCGAAAGGCATCCGCAACCACTCTAACAACCCTGATGGTGTGATAAAGGCGGAAATCGCCCTTGCTCTTTCCGTCAACTCCACCACC
CAAAAACCACTCGCCATGTCCAGAGAGCAGTACCACATAGCTTTATCCATGTCTTGCAATAGTTCGCTGATCAGTGACATCGGATACACCATCAACCTAG
TCAGCTGGTCACCCGCCCGTATTCAATACACAGCCTTATGTCTTCTCCGTTTTTCTTGATGATCACCACTATGGGGGACACCCATGGTGATGTAGACGGT
CGAATGATCTTGTCCGACAGTAATCCCTTGATCAGATCGGCGAGTTTTTCTCGGAACTTTGGTGCTACAGGTCGGACCCGTTGTGCGATCGGGTTAGCTC
CTCCCACGTCGACGTCACAAACTGCCCCACGCGCCGCAGGAGGTAGGGCGTTACCCTTTCCAATAAGTAGATGCCGGCTCTTCCAAATCGTTTGGCGCAA
CTTCTCTTGATCCTCGGTTCTTGGGGTGCCGGGATCGCCTACTTGAATATCATCAATCATTATTTCTTGTGTGGGCGTACCCACTTCGGGAAGAACTACC
ATGTGCTGATCCACATCTTCCGCGAACAACTCGCCACCATCATGTA