Description :
From Genome Similarity Track
Location :
Scaffold_1414:2884- 4372
Transcript NameFunction/comments
Phyag_g10561hypothetical protein PHYSODRAFT_347255
Phyag_g10562hypothetical protein PHYSODRAFT_340908

Sequence
1488 bases(100 bases per row)
GTGTGTGGGGCGAGTAATCCCCACGTCGTTTATGGCTTCCTTGAAGATATTCTTGAgactcggtggtggcggGACTCCGAGGCGAACGGAGAAACTCAGT
CCGTGCGCCTGCTCGGGTCCGTGATACGGATCCTGGCCCAGAATCACCACTTTCAGGTCGGAGAAGGCGCAGTCTCTTAGCGATGCGAACACGTCGGCTG
GTGGTGGGTAGATGGTCTTCTTACGACCTTCCTCGGCCTCCAGGAACCTCGTCAGCACTTGGAACGAGCCGCGCGCAAACTCTTTCTTTAGCAAGTCGAA
CCACGACGGGTGCATGAGCGAGCGCAAGGACGCTGCCTTCTGCATCCCAGCAAAGCTCACGAtgggcagcagctcgccctgctcgtcgtcctgtTCCGAG
TCCTGGTGCTCATCTGCTGCCTTGCCCTGTGTTCCCGCGTTGGCGCTCGcctcgccttcttctgcgacCTCTTTACTCACACTGAGATTGTCGGAGTCGC
CTTGTTCCTGACTTGTAcggcgcttcttggccggcGGCTGCACCCCGAAGAAGGAGCGGATATCGCGCGTGGTTCCCGCCATCTCTTGTGCCGTTATGCA
GAATTTCTGCTACAGAAAATGCACACAAACCTGAATATATTTTAAAATTTATGATCTAAGATGAAATTTTTCTTACGTTCGACCACGAAAGGGTTAAACA
TGGGATGGTTCAAGAAGTGTTACAGAGCTGCCACGACTCTCTGGAAGGTGGCCACCAAGGTATTGTCCGGACCTATCACAGGGTCAAGTTGGACTACTAT
TGGATCGGCCTATATGCAGATGTCGAACGGCACGTGAGGTCATGCCCCGACTGTAGCTCGAGCAAGAGCCGACCGCAGTTCCGCGGCTACTCGCGCGGAA
ACATTCTCGCCGAGCGACCGTTCCAAATCGTCTTGATGGACTTTGTTATACCTCTACCGAAGTCTCATCAAGGGAACACAGCTCTTCTACTCTTTCAGTG
CGCGTTCACGGGATATGTGATGGGCAAAGCTATGGCGGACACCACTGCTCTGAGCGTGGCAAAAGCATTCCAAGAGTGTGTGCACGCAAGGTTCGGTGCC
CCTACACTGATTCGCCATGACCGAGACCCTCGGTTCATGAGCGAGGTCTTCCAAGCCTTCACCGAGATGATGCAGTCAAGGTCGAGAGCGACTTTGAGCT
ATAGGCCGCAGGCTAATGGCCAACAGGAGCGATCGGTGAAAACCGCGATGCAATCGGCGCGGGTATACACCGAGGATCCGCTGCAGCAAGATTGGGATGA
GATCGCCGAAAAATTGATCTCCGCTATCAACAACTCGATGGATACCACGCGAAGGGAGACGCCGCATTACCTCGTACACGGATGGGACGCACGGTCCACC
CTTCGAGCCATGGCTTCATCGCTCAAACGAGGTTCTGGAGGACAGACCGATGCTCTGGCATGGCGCCGAGAAGTCAACCGACAACAAG