Description :
From Genome Similarity Track
Location :
contig_5:288371- 289850
Transcript NameFunction/comments
g1673.t1POM69186.1 Microtubule-associated protein [Phytophthora palmivora var. palmivora

Sequence
1479 bases(100 bases per row)
AGCTTGAACTGCAGTAGCACCATGACAATGCGTAAGGACGGCTCCTTTTCACCCGCAAGGTGATAGTAAAGCGTAGCTCGCTCTGGCGAAATGAACGACA
CCCCGAGACCATGCTCGTGCATGTACCCCACACTGAAAAGCGCTCGCGCGCTTGTGCCAGCACTCACCAGGTCTGCATGTTGATAGTGCCTTAGCGCAAC
AGTATAGTCTTCATCTTGGTAAGCACTGTCACCCATACGCAACAGCGCGTCAATGCTGTCTTGCTCAAAGGCACGATTCACAAGTCGAGCATATAAGCGT
TCAAGCAGCTTTGAGTCACGGATAGAGGGAGTGCCAAATACTTGTCGCTGAACACGTTCAATCAGCCAGACAGCATTGTTCTGCGCGACTTCATAACCCA
TTTCAGCAGCAATCAAGTACAGCTCCAGCGCTAGCGCCCAGTTGCCTCGTTGCGCGTGGGTCAGCGCTTGTGTCATCAATGTTGTTCCTTCTCGTGAGTA
TTCGGCCACGCGCTTATAGAGCTCAACAACTTCTTGACACGATGTACTGCTCGTGGTTGCACCTCCAATGGTGTGAATCTGCCGCTGCTTGAGTCGAGCA
AGCTGGAAAAGCGACTTGAGATGGCCAACGTGTGCCGCCGCAACGAATACTCTTTTGCCCGTGACGAAAGGTGAGACCCGAGCTCCAAGAAAGACATGCC
CGTATTGTAGACACCTTCGGCATGACCTGCGTTAGCTGCAACTTTGAAAAGGTGCGAGCTCTGTCAGGATCGACAGGCATGTCACCAATGCCGCGCGAGA
AAATAACACCGAGGCCATTTGCTGCTTCACCGCTAGGATTTCCTTCCGATGCGTTCAATGCAGCTTCGTAGAGCTCTACAGCTCGTGAGGCGTTGGATTT
GCACCCTGCAAGTCCGTAGGCGTACACGTGACCGAGAAGAGCCTGAGCCTTGATGCTGCCCATTTCAATTGAGCGCTCCAGAAATCGTAGTGCCTCACGT
TCACGAGCAGCGTGTTCTTCAAGATCAGACATAGCTGTAACACCGTACAGGTCGCTGAACAAGGTGATGCTAGCCGACTGAACCATCACGTCGGTGTTGC
GGAGGTCAGCAGCACGCTGTCTAAGATACTCAGCTCTGTTGAAGTCTTCTGCCGGGTTGAGATCGCCATGATATCGGGCACCCTCGGTCTCGGAAAGCCT
TGCAGGTTCAGGAAAGGCATACAGCTGAAGCTTCTGGTCATTCTGCTGGGTAACGACTCGATCCGCGGCGAACTTGTAGTGCCTCATAGCTGCCGTACAG
GACTTCCTTGAGCCGTAGCCGTGTAAGGCGCGATAACCAAGCGCCATGGAAGCACCGATCGATTGTCCACGAGTAGCAAACGCGTAGTATAATTGAGCAC
CTGCACTGTCATCAGAGGCAGCTCGCAGAGCACCTAGGAGGAACTGTGCTTGGGAACTGCCGTGCCCAGCACTAGCTTG