Description :
From Genome Similarity Track
Location :
contig_51:28836- 30545
Sequence
1709 bases(100 bases per row)
TTGATAAGAAGCTAAAGCATACTAGCTATCGATACGTTCTTGATGAGTTTCATGCTTACGTTGAACAAAAAAGAAAAGTAGCTTCAACGGCGTCGAAGGA
TGGTGGCGCCCTTGGGCTTAGCCTTGACGACTTCTTCTTCTGAATCGCTTGACTCATCATTGATTACGATTGGCTTCTTAGTGCGTCCTCTGCGCGCGGA
GCCTTTTTGTCTCGTTTGAATACGCATCACTTGTTTGACAACAGGCGCTTCTTCATCAGTGTCTACTTCGGATGCCGCCGGAGAGATTGCGCCCTTGCGC
TTCTGGTGGTAGCACTTCGAATGAAAGATTGAACAATGGACGTGGTTCACATCTAGTAATGTGACATATGGCTCTTCAGGTTCATACTCAGGAAGCCGCG
GCAGTTGCTTATAGCGTTTAGCAAATGCTTCTGTATCCGCGTTTGCCTCTGCTCCGATTTGTACTTTTGGAGTAAACACCGGAGTAGACTGAGCCGAAGT
AGACACTCTAGTCGGAGCAAACTTAGCTGAAGTAGACCTCGGCGAGTAGACCTCGGCGGAACAGACTTGGCCGAAGTAGACCTCGGCGGAGCAAGTGCTC
TTCTCGGCGACACTTGCTCGCGAATGCTTCAACATCAGTAGTAGTATCATCAATACTACTTTGATAGAATACGATTGCTTTCACGTCTGGACGGCGGACG
CACTTCCAAGAAGAAACTCCTCGTTCAGAGTTGAATATCAAGAAGAGTGTATTGTCATTGTCATGAACTCGATCGCACATTGAACACATGCTGGGCGCAT
ATCGTTTGACATACATTGTTGACTTGCGAAGTATAGACGTTGAGATGTCCCATGCGCGATCGGAGTAGTCGCTTCTGTTGTTAACATGCTTCAGCACTTC
TTCTACAAACGCGGGACCAGCTGCTTCGCCTGGGTACGCAACATCGTTGATGATGTTATACTCTGATAGATCCACATCATCAATGGTGAAGATATCATCA
ATCGTTACGAAGTAGTGTTGACCAGCAGTGCTGTAGTCATGATCGATCCAATTAGTTGAATCACCATGCGCGCATTGCTTGGTGCCGAATGGTAAGCTAA
GTGATCCGTTGCGATGATACTGAGTTGCATCGATTGAATCAATCAAGAGATCAACAATGTCATCGTCGATCATGAGTACCTCCGTGTTGTCTCTGATCAC
ACTAGTTTTGATATGATCAACAACTGCGGCACACGCTTTGAGCGACAGCATCAGGTTTGTAACAATATGAATGCTGATCTTGTATCCATCATTCGCTAAT
GGGCGATTGCGCAGTGTTGATAACCAATCGAAGCGAGACAGAGAAGAGTCTTTAGAATCAATGTCAACACCATGCTCTTCAAGCGATATCAGCGTTGCCT
CTTTGAACGCGATTGCTAGTTGCTTCCCAATTGTCTCCATTACATACGCTTCGTTGTCAGTAGAGAGTTCGATGTTGATGCTTTCGGCTAATTCACTTTT
CTGAAACTCATTTAGTTTCAAGTCAGTATCAAAGAACATGCGGCAACGCGGAGTGATGATCAGTTCATGAGCTTCCATCTTCAAGTTCAGTCCTACGAAC
TGATTGAACTTCAATGCATCTTGAATGCTGTACAGCCAGTAGAACGCTCTGCGTTTGGATCGAGTCTCTACTCGCAGTACTAGCATGCTACGCTGGATCG
GGTGCATGT