Description :
From Genome Similarity Track
Location :
Scaffold_196:28831- 31094
Sequence
2263 bases(100 bases per row)
ACGCGTGGGTGTGTGAGGCCGTTCACGTAGAACGGGGTATAGCCTGTCGAGGCATGAACTGCATTGTTCATGGCGAACTCAACAATGGGGAGCATTGAGA
TCCAACGCCAAGGAATCTCAGCGCACACACTGCGTAAGACGTCACCGAGGACGTGATTGACACGCTCAGTATAACCATCGGCCTCCGGATGATCCGCGGT
AGACATTCCTAATCTGGTGCCGAGCACCTTGAATATGGCCGTCCAGAACTTGCGCGCAAAACGAGGATCGCGGTCAGAGACAATTGCCAGTGGCAGTCCG
TGTTGGTGAAAAACACGATCAATAAACAGCAAAGCTGTATCTTCACCATCAATCGAATCCGGCGCAGCCGCTAAGTGAGCCATTTTGCTCAAACGGTCAA
CAAAGATCGCAATACCTGTGTTGCAATCCGAAGCCTTTGGTAGGCCAAAAACGAAGTTAATGCTGATGGACTCCCAACACCCAGAGGGTACAGGAAAACT
CGCCAGCGGCGCAGTCGCATGAGCCTAGGGTTCGACCCGTTGGCACGTCTCACATGTGCGCACATAAGTGCTTACCCATTTATAAAGTTTGGGACACCAA
TAACTCTGGCTAACTTAGCCGTAGGTCTTTTCACGACCGAGAAGACTACTAATAGCTGTGTCGTGGACCTCATAGAGAATACGATATTTCAGTTCCTCAT
CATGAGGAACAATGATACGCGGGGTATCCGCAGCATCCGTGCGATAGCACAACAATCCATTATCGATAGAATATCGATGTAGCCTCGCACGCGAACGTAC
CGACAATTAAATGTCCAAGTCGTTAAGCTCATCGCTTCCAAGAGCAGGTAGCAAAGCTACAAATTGTTCATCCTTGGCATAGGATGCACGGATTAAGTCA
GTAATTGACGACGACAACATCGTAACATGAGCAAGCTCATAGTCGGGCTGTCGTGACAGCGCATCAGCCAGCGTATTTTGCTTTCCCGGTTTATACTTCA
CCTCGAAGTTATAGTCTGCAAATAATGAAATCCAACGGGCCATCCTCTGCGAGAGCTGAGACGATTGGGTCACCGTGCGCACAGACGCATGATCGATATA
GACTACAAAAGGCTTAGAGCCAAGCAGATGAAATCTGAATTCGACTAGATCCTACTTCATAGTAAGTAGCTCCTTGTCGTGAACTGGATAGTTCTTTTCA
GCAGCTTTGAGCTGACGGAATTCACAAGCGGTGACACGCTCGCGTCCCTCAGCATATGTTTGTAACAGAGCACAGTCAATGGAAAAATCCGAAGCGTCAC
AGACGACACTGAAAAGCCGATCGGAATCTGGCAAAGCCAAAATCGAGGAATGTAGGAGACTTTCGTATACGGCCTTAAAAGGATCTGCTTCGGCGCTAGT
CCATCACCACTCCACATACTTTTTAAGGAGATTAGATGATGGCCGAGCCATATCAGCGTAATTTTCGCTATACTTGTGCAAGTAATTGGCAAGGCCAAGC
CATTTGCGTAAATCCTTTTGATTCTTAGAAACTAGCCAATCCACTATGGCCTTAACCCTTGCAGGATCTGCCCGAAGGCCTCGCTTCCCCATGAAGCACC
TTAAAAATAGGATCTCATCCGCGCCAAAAAATGCATTTCGATGCATTAGCATAGAGCTTATTATTGCACATACACTCTAGCACAGCTCGTAAATGGTCGA
TGTGGTTATCCACGTCCGCCCGACCCTGTTCCGCCCGACTATGGACACATATGTCATCGAAATATGTTTGTGCATACGCACGGTGAGGGCGTAACAATTG
TGTCACCAGACGATTAAACGTAGCCAGGGCATTGGAAAGTCCCTGTGGCATAACCAGCCACTCCCAAAGCATATTGCTTGGAGTACTAATCGCTGTAAGC
GGGATATCACTTGCTCGCATGAGCAGTTGATAATAACCATCAACCAGGTCGAGTGCACTGTACATTGTAAATCCTTCCTGTTGTTCTGAAGAACGTCCTT
TCTAGGAATGGGTGTTGTGTCGGTATAGTGGCCGCATTAAGCTTATATAAGCGTGCATAATACTTCACTTACCATTAGTTTTTTTTAAAACAAAATGTCG
GTGTGGAATGAGGAGACTCACTCTCCCGCACCATTCCCGTCGCGTGCTTAGCACTGATAAGCTCGTCAATGACATCACATCATTCCTTTTGATAAAGGCC
ACTGCCTTGTAACGCAGTATATAGTTCTAGGAACCAAGTCAATTTTATGACGTACGCCCCTAT