Description :
From Genome Similarity Track
Location :
Scaffold_688:2883- 5277
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_688-snap-gene-0.6Codanin-1.
Pytir_DAOMBR486maker-pir_contig_688-snap-gene-0.4Glycosyltransferase

Sequence
2394 bases(100 bases per row)
TACCTGTGGCACTTGCGCTGGCGGCTTGCTGGGAATGCACTACTTGGTGCAAGTGGCCGAGGAACGCGTGGATCAGGTCGCTCGGCGACCACTGTGTGAC
GCGAGACTTTGTCCTTGCCGCCGCCTTCGCATCGTCCGCATGCGCTGCGTCGTTGTCTGCTTGGTTGCCTTCTTTCGTTGCTCCACCGTCATCATCACGG
ATCTTCTCACCTGCTTGTTTCGACTGGTTGCTCACGCCACTCGCCTCGACCAGCATGAGCGGAATGCGCTCTGCGTCCTTTCGCGGCGAAGTTGTCTCGT
TCGGTGCCAAACTGCTGCTGCTGTGCGAGCGCAGGATGAGCTGCTGTATGCGCTCCAGCTCAACGTCCGAGAGGCGACGGATCGCCTCCCACACCTGCGC
GCGCGTGCGCTGCTCGCTCTCGTCCGCACTCATCCGCGCCGCCAACGCCAAGAAGAGCTGCGCTCGTCTCGCACCTCAGAGAATTTTTTTCGCCAAATAC
GCTTTTGAAAATGGGAGAGCGCGCTAAATTCAAAGGTGCGTACACATTTGCAAAAGTGGGTAAATCACTTCTCCGATACACTTGTTATTTAAAGTATTTT
GTTCAGCAATACAATCCAGATACACACACAAAAAGGATGATTTTCGCGCCAAAAAATGTTCCTCATAAATTCGCTTTTGTCCAAAAAAAATGAGTTCACA
GATTCGTTGCTCTGGTCAAGCAAAGCAGATCGACTGCGCCGTGACCCCTGGTAAGAGAATGGCCTGGCACTACAGTCGAGAGCAGCTTCAGCTCACGGAG
AGTTGCGCTGTTCAGGTATGTGTGAGGACGCTTCATATGGCAATCTTGGTACAAACCGACCTTTGTATATTGTGGAGCGGTTTTAGCAAAAAGTCATTAT
AGGCTATTTATGCAGGCTGAAAAGCTTTTCTAGGCTATTTTTCATTTTGGCTCAAGTCTGGCTTGTTTTTGTCCACTTTGGAGAAGGGAAAAAGAGTTCC
GACATCACTCGAAATGCTTCGAGAACAACTGGAGAGGACTGCGCTGCCAGCTTGAGGCAAACAAAGAGCCATTTGAGTTGGTTCCTATTATAGTTGCGGC
ATTCTTTCCGATGCTTCTCTCGCTTGTGCGGACAAAATAAAAAAACATGAGAACTTCGCGAGCGATCGAGCGATCTGTGCGCATCGCGCTCGTCCATCGG
AAGACAACATTCAGCCACAACAAGTGGCTGGATAAGTGGCGCATTTGCTTGGTTGTCAGATTGCCCGCACGATCGATACTGTATTTCGATCGCCACGTTG
TTTGTCAGATCCTTTCAGATTCCACCCAGCTGCTGGATAGTACATTCATAGCTCATTTAGGTTAACTGACGAAACGAGTTTGATGGAAAAATAAGAACAC
GGCTCAGTCCTGCTGAAAATGAATACTTCACCAGGTAGGCAAAGTGCTCGAAAGAAAGAGGCACAAATGGAGAAGGGCTGGGTTTGTATGAAATCAGGCG
TTTCGGGTTATCGGTGTATTCAGAGCGGTCATCTGTGCAGCTGAACTAGCAAATGGCTTGGAAACCTGTGCGTTGCTCGTCAAACAGAAATGGCTCAGAA
CGTGTCCATCTAGGGAAAGGGGTGCGTGAACTGAACCAAAATAGATTTTTGATGCGAACTCCAATACAAAAATCGAATTGGCTGCCCTCCCCACATCAGC
GAGTTGAGGGAACAGATTTGATGCGAGCTTGCGAGCATACAAACCCCAAGTGAAAAAGCTTGAAGCCAAAAGCCAGTCCCAAACTTGCCAGTTTTGGTTT
GGTTGTTCCTCTCCCCCTTTCTGACAAAACAGCCTGAATCGAATTATGGTGTGGCTTCGAAAGACCTTACTCACAAGCCACAGATAACAAACGCCCAGAA
GAGAGAGACAGAGCAAGCGACTGCCGCACTCACTTTCTGGCGCAGTCTGTCGGTTACAACACTTTCCCTTTCCTTCGCCAAGCCCGCAGAGCCTGCAGAG
TGCGGAAACCAGTTCCCCCCCTCAGCTCAGTTGCTGTAGTCAGTGCGGCAGGCAGTCTCACTCGTGCAGTCAACGCGCTTCCGGAAGCGAAGAGAACGTG
ACGATGGCGCAGGCCACGGCGGCGAGCAAAGAGCGTCGGCGCGCAGGCTCCAACTACTTCCAGCTGGACGCCGACCGCAAGCGCAATAATTCGACGCGCT
TCCCGAACGGCGGCGGCGGCAATGGCGACCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATGGACGTCATACCGTCGCACAATCAGGGCGGCGCGCC
GAACGTGAAGCTCGGTGGCGGGCTCCAGGGTGACTTTGACGACGAGGTCTCGATCGACTACTGCTGCGAGGTGCTCTTCAACAAGTTCGGCTTC