Description :
From Genome Similarity Track
Location :
Scaffold_32:288255- 289656
Sequence
1401 bases(100 bases per row)
ATGATGTCAAATGCAAAAGTGTTGAGTGATCTTATGAGCTTCAGATTTTCGCGCCATGGGGCTCGCGCCTCCGCTACTGTTCGGATAATTCATTCTCTTT
GAATTGATTTCTGTGTGCGATATTGGGTTACAAAAGTATTTCAGTATTAGAGTAAGTTGAACTTGATTTTGATTGGCTCGTGCACCCTCTCCATAAATTG
GCGCATGTCCATAAATTGCCTCGTTACGTTAGTGAAAAACTTCCTCCCCTACAGAACGTACCATTCACCGTTGGTACGATTAACGGTGTACAACGTTGTA
TGCCTTCGTGTTTCACGTTAACGATAGGATTGTACTTATCGTAGCAAGCAATTAGTCCCACCCACTTACTCAGGGACGTTTTAGGTCAATAACGTTAGTA
CCAAATTTGACCAATTGAGTGGGTGTGTACTCACTCGGGGAATTGGTCTGTCAAACTCAAACTCTTGGAGCCTTCGAAGAGCCAGAATATTTTACGTGAG
TTTCACTTCGCTGCGACATGTTTGACTTTCAAATTCTAATTCACTGTCATCGAATCTTCGAAAGAGCTCTACGTTTAATCTCTAGACTTTCCAGTTCTGG
ACGGGGAGATGCGGGGACTGGACGAAAACTCATCATAACACAGTTACAGTGTATGTAAGGGGCAAAATGGTGAAATCGAGGCATTTCTGGATGGCGAAAG
CTTTTTCGGAGTCAACCAACTTTTTGGGGAGGGACTTTGGCTGCTGTACTGATACGCTCACTGCAAGTGTACAGTAGTGTTCAGAAAATTCGCGCCGTTT
CACATTGAAAACTGAGCAGTTCCGGATACTGCTTTACATTTGCGGATGATATATTTTTATTGCGCATGTGCATGTTTTACGGCTTAAATGTTTCGCGATC
CACAACTACAGTATTTAGGATTAGCCAATAGAATCGTTGTCGGGATTTAAGCATCTCGACCGTGCTGGGTAGTTTACAGTTAACGTTAAGTAACGTAGGA
AAAAACTGCCTCCGGTAAACTGGCCTTCTACGTTAGACCAGGTAATTATCCTGTCGGTGTGGAGATATTGCTCTTTCGGCTTGTAAACCAGCGATTTTGG
GAGCACAGGTTGTTCGACAAGCTGAATTTGCACTTCGAGCTTCAAGTCACCATTACACTGTAGGGAAAACAGGGTCCATTACAGTGTAGGGGGTCTATAT
TAATGGGATCTATATTATGTAAGTAGGGAAATACATGTACAGTAGGGCGGCCAGTATGTACCGGTAGTCCTGACACATGAATAGTATCCGATGCCATGTA
CTTCGAAGTAATAATGGGAAAAACCGTGCACACGAAATCTCTCTAATACTTATCACTCTATTCCGCAAAAATGTTAAGCTCATAATTGTTTTCAAAGTGC
T