Description :
From Genome Similarity Track
Location :
contig_51:28823- 30533
Transcript NameFunction/comments
g8601.t1hypothetical protein

Sequence
1710 bases(100 bases per row)
GCTTGACTCATCATTGATTACGATTGGCTTCTTAGTGCGTCCTCTGCGCGCGGAGCCTTTTTGTCTCGTTTGAATACGCATCACTTGTTTGACAACAGGC
GCTTCTTCATCAGTGTCTACTTCGGATGCCGCCGGAGAGATTGCGCCCTTGCGCTTCTGGTGGTAGCACTTCGAATGAAAGATTGAACAATGGACGTGGT
TCACATCTAGTAATGTGACATATGGCTCTTCAGGTTCATACTCAGGAAGCCGCGGCAGTTGCTTATAGCGTTTAGCAAATGCTTCTGTATCCGCGTTTGC
CTCTGCTCCGATTTGTACTTTTGGAGTAAACACCGGAGTAGACTGAGCCGAAGTAGACACTCTAGTCGGAGCAAACTTAGCTGAAGTAGACCTCGGCGAG
TAGACCTCGGCGGAACAGACTTGGCCGAAGTAGACCTCGGCGGAGCAAGTGCTCTTCTCGGCGACACTTGCTCGCGAATGCTTCAACATCAGTAGTAGTA
TCATCAATACTACTTTGATAGAATACGATTGCTTTCACGTCTGGACGGCGGACGCACTTCCAAGAAGAAACTCCTCGTTCAGAGTTGAATATCAAGAAGA
GTGTATTGTCATTGTCATGAACTCGATCGCACATTGAACACATGCTGGGCGCATATCGTTTGACATACATTGTTGACTTGCGAAGTATAGACGTTGAGAT
GTCCCATGCGCGATCGGAGTAGTCGCTTCTGTTGTTAACATGCTTCAGCACTTCTTCTACAAACGCGGGACCAGCTGCTTCGCCTGGGTACGCAACATCG
TTGATGATGTTATACTCTGATAGATCCACATCATCAATGGTGAAGATATCATCAATCGTTACGAAGTAGTGTTGACCAGCAGTGCTGTAGTCATGATCGA
TCCAATTAGTTGAATCACCATGCGCGCATTGCTTGGTGCCGAATGGTAAGCTAAGTGATCCGTTGCGATGATACTGAGTTGCATCGATTGAATCAATCAA
GAGATCAACAATGTCATCGTCGATCATGAGTACCTCCGTGTTGTCTCTGATCACACTAGTTTTGATATGATCAACAACTGCGCACACGCTTTGAGCGACA
GCATCAGGTTTGTAACAATATGAATGCTGATCTTGTATCCATCATTCGCTAATGGGCGATTGCGCAGTGTTGATAACCAATCGAAGCGAGACAGAGAAGA
GTCTTTAGAATCAATGTCAACACCATGCTCTTCAAGCGATATCAGCGTTGCCTCTTTGAACGCGATTGCTAGTTGCTTCCCAATTGTCTCCATTACATAC
GCTTCGTTGTCAGTAGAGAGTTCGATGTTGATGCTTTCGGCTAATTCACTTTTCTGAAACTCATTTAGTTTCAAGTCAGTATCAAAGAACATGCGGCAAC
GCGGAGTGATGATCAGTTCATGAGCTTCCATCTTCAAGTTCAGTCCTACGAACTGATTGAACTTCAATGCATCTTGAATGCTGTACAGCCAGTAGAACGC
TCTGCGTTTGGATCGAGTCTCTACTCGCAGTACTAGCATGCTACGCTGGATCGGGTGCATGTAGTTTTCGGTTTTTGGATCTTTGAGGCGGAACGTTTCA
TGCCAGTTCCCGGTTGCGTTTGATTCAAGGTTGGCATGACACTCGGAGATGATAGGCATCGTGTATATTAGGTTATGACAATTGCGATTTTGTGATAACC
CAAAAAAAGC