Description :
From Genome Similarity Track
Location :
Scaffold_53:288152- 291586
Sequence
3434 bases(100 bases per row)
TTGATCAAAGCAGCCGCAACGCTCTGCCGATGATCATGGGGGCATATACAAGCGATGTGACAGACAGTGGGATAACTACGGCTGATCCCAAGGTGTTTCA
CCGTAGCCTGAGAGTCAAATGCATGAAATGCCTACAGCTACCATGGCAGAGACTGATTCGCCGGGAAATAGCTCATTAAGGAAGAATAATTTTGCTGGAA
CTAACCGAAGTCAAAGTGACATGATGCTAGCGCACGTGCTTACCGAATTGCGTGATATCATCGAATTCACACATGTCAGCCGCGAAGCCGAAACATCTTT
GAAACAGCGCCTAGTCGACACAACCAAAGCGTCAGCGATGGAATACGGAAGTTTCGCATGGCGAATACACCAATGTACATAGTCCAGCCGAGAATGAAGG
GTTGGTACGCTGGCGGTTATCGCCCTTCTGACCGGAAGCGTGAAGGGGACTCTAGGACGTCTCTTCAAATATGTGTTGGGCCTAGAGGAAAGTGATAATC
GGAGGAGCGTCTGGAATAATTCCCCGAGATCGAAGATGTACCGCTATGATCATACAGGATAATAACCCTAGCCTTAGCTATGTTTGCGTCGAGGGAATAG
ATGGTGCTTCTTTCGCTCAGGCTACGTAAGTTTACTTTTGCAAAAATACTTGTGATCGCTCGCATGTTTATGGTGCAGCTTTTATATAAATATGTCCGGT
CCTGCTTCTCGGCTAACAAGAAATGGCATATAAGCAATAACTAACGTGGGCCAACCCAGACTTATTCAGCCGAGTAGGACTAAGTTTAGGGCGGTGTGGC
TTCCCGGGTCAGGATAGATTGCTGCTAGGTGGGACGGGTAGCCGTCTTAATCATGAAGTAGGAAAGCAAAGCGGAAAAAAAGTGATGTTCAAACAACTGC
TTTGCGTAAGAGCAAAAGGTTTTCGTTGAAGCCAGCATAGTTCTTCGAGGTATCGTGCACTTATATCTGGCTCCGGCCCCGCCAAATGAAGAATAGTCCC
CACTGCCATATCGTTAATATAGAGTAGGACAAGCGTACAAGTGGTAATTTGACGTACGTCATGTTTGCGGCAGTTGTGATTTTTCAGCCAGCTATTAAAA
GACGACCTCACAAAACTATGCCAACTTAACACGCAACCTGTCTTCGATGGCGCAAAACGCTTACATGTCTTACACACAAATGGGAATTGATCAAAGCAGC
CGCAACGCTCTGCCGATGATCATGGGGGCATATACAAGCGATGTGACAGACAGTGGGATAACTACGGCTGATCCCAAGGTGTTTCACCGTAGCCTGAGAG
TCAAATGCATGAAATGCCTACAGCTACCATGGCAGAGACTGATTCGCCGGGAAATAGCTCATTAAGGAAGAATAATTTTGCTGGAACTAACCGAAGTCAA
AGTGACATGATGCTAGCGCACGTGCTTACCGAATTGCGTGATATCATCGAATTCACACATGTCAGCCGCGAAGCCGAAACATCTTTGAAACAGCGCCTAG
TCGACACAACCAAAGCGTCAGCGATGGAATACGGAAGTTTCGCATGGCGAATACACCAATGTACATAGTCCAGCCGAGAATGAAGGGTTGGTACGCTGGC
GGTTATCGCCCTTCTGACCGGAAGCGTGAAGGGGACTCTAGGACGTCTCTTCAAATATGTGTTGGGCCTAGAGGAAAGTGATAATCGGAGGAGCGTCTGG
AATAATTCCCCGAGATCGGAGATGTACCGCTATGATCATACAGGATAATAACCCTAGCCTTAGCTATGTTTGCGTCGAGGGAATAGATGGTGCTTCTTTC
GCTCAGGCTACGTAAGTTTACTTTTGCAAAAATACTTGTGATCGCTCGCATGTTTATGGTGCAGCTTTTATATAAATATGTCCGGTCCTGTTTCTCGGCA
AATAAGAAATGGCATACAAGCAACTACTGAAGTGGAGCCAAACCAGACTTATTCAGCCGAATAGAACTAATTTCAGGGCGGTGTGGCTTCCCGGGACAGC
AACGATTGCTGCTATTTCCAGGGAGGGGGGACCGACAGTCGTCTTAATCATGAAGTAGGAAAGAAAAATGGCAGATAAAGTGATGTTCAAACTACAGCTT
CGCGTAAGTGCAAAAGGGTTTCGCTGAAGCCAGCATAGTTCTTCGAGGTATCGTGCACTTATATCTGGCTCCGGCCCCGCCAAATGAAGAATAGTCCCCA
CTGCCATATCGTTAATATAGAGTAGGACAAGCGTACAAGTGGTAATTGGACGTACCTCATGTTTGCGGCATTGTGATTTTTCAGCCAGCTATTAAAAGAC
GACCTCACAAAACTATGCCAACTTAACACGCAACCTGTCTTCGATGGCGCAAAACGCTTACATGTCCTACACACAAATGGGAATTGATCAAAGCAGCCGC
AACGCTCTGCCGATGATCATGGGAGCATTTGCAAGGCATGTGACAGACAATGGGATAACTACGGCTGCTTCCAAGGTATTTCACCGTAGGTTGGGAGTCA
TACTTCATCCAGCCGAGAGGGAAGGGTTAGTACGCTGGCGGTTATCGCCCTTCTGATCGAAAGTGTGAAGGGAACTCTAGCGTCTCTTCAAATATGTGTT
GGGCCTAGAGGAAAGTGATAATCGGAGGAGCGTCTGGAATAATTCCCCGAGATCGGAGATGTACCACTATGATCATACAGGATAATAACCCTAGCCTTAG
CTATGTTTGCGTCGAGGGAATAGATGGTGCTTCTTTCGCTCAGGCTACGTAAGTTTACTTTTGCAAAAATACTTGTGATCGCTCGCATGTTTATGGTGCA
CCTTTTATATAAATATGTCCGGTCCTGCTTCTCGGCAAATAAGAAATGGCATACAAGCAACTACTGAAGTGGAGCCAAACCAGACTTATTCAGCCGAATA
GAACTAATTTCAGGGCGGTGTGGCTTCCCGGGACAGCAACGATTGCTGCTATTTCCAGGGAGGGGGGACGGACAGTCGTCTTAATCATGAAGTAGGAAAG
AAAAATGGCAGATAAAGTGATGTTCAAACTACAGCTTCGCGTAAGTGCAAAAGGGTTTCGCTGAAGCCAGCATAGTTCTTCGAGGTATCGTGCACTTATA
TCTGGCTCCGGCCCCGCCAAATGAAGAATAGTCCCCACTGCCATATCGTTAATATAGAGTAGGACAAGCGTACAAGTGGTAATTTGACGTACGTCATGTT
TGCGGCAGTTGTGATTTTTCAGCCAGCTATTAAAAGACGACCTCACAAAACTATGCCAACTTAACACGCAACCTGTCTTCGATGGCGCAAAACGCTTACA
TGTCCTACACACAAATGGGAATTGATCAAAGCAGCCGCAACGCTCTGCCGATGATCATGGGAGCATTTGCAAGGCATGTGACAGACAATGGGATAACTAC
GGCTGCTTCCAAGGTATTTCACCGTAGGTTGGGA