Description :
From Genome Similarity Track
Location :
Scaffold_205:28812- 35614
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_205-snap-gene-0.15Conserved gene of unknown function
Pytir_DAOMBR486snap_masked-pir_contig_205-abinit-gene-0.24Gene of unknown function
Pytir_DAOMBR486maker-pir_contig_205-snap-gene-0.16Glutamate synthase
Pytir_DAOMBR486maker-pir_contig_205-snap-gene-0.19Expression site-associated gene

Sequence
6802 bases(100 bases per row)
CCACGTACTCGAGTCGGTGCCCGTGGGCAACTGCCCGCCGTTCGCCGACAACTCGATCGTGCGCACCAACATGTCGTTCTGCTATTTATTCCGCGAGAGC
AGCCAGCCGGGGCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGTTGACCGCTGGCGGCGTTGGCGACA
ACCGCAGCGCGATGGAGATGCTCTTCGGACTGGCGACGGCGTTCGTGGCCGCCGAGGCGAAGAAGCTCTCGGCGCTCGTGGCCAAGCAGTCCCGCCAGCC
CGTGACTAAGACCAGCGGCAGCCATTGCTCGATCTGCCGCGCGAAGCCGGGACTCTTGTCGTCGCACCTGGCGTGCCAGGGCTGCGGCGGCGTGATCTGC
ACCAAGTGCCGCGTGAAGAAGCAGACTTTTTCGCGCAAGGGTAAGATCAAGGTGTCGTGCTGCAAGATCTGCCTCGTGAACGTCAAGGACACGTCGCCGT
TCGAAGGCATGACGTTCGAGCGCCAGCCGCTGAACGCACTCAAGAAGAAAGCGACCGCGTCACCAGCTGCTGCCAATGAGAGCGCCGCCACACCGGTGCA
TCTTACGCAAATGGACCACCACCACTACCACCAGCAAGCTGCACAGTCGTCTCGACAGCCAACGATGATGATGGCGCCACAGCACCAGCACCAGCAACAA
CATAACTACGCGAAGCTGCAGCGCCACAACTCGAGCGGATCTGCGACGGACACTGAGTACTCGCAGTCGATGCAGTCGTGGCCCTCGAGCTCAATCTCGT
CGGGCTACTCGGACATCGACGACAGCTCGTACTACCCGACGCTGCAGCAGACCCCGGAGCACGGCTCGCAGCTTGTGGTCATGGACCGCAAGATGCCTGG
AGGTGACGGACCAGGCTACGGCTTCCAGCAGCAACAGCAAATGTACCAGCCACAGCAGCAGCAGCTGGCACGGNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNCTCGCAAGGTCAGTTGGTGCCGCAGAACCAGAACCAGATGCACTACCTGCCCAACACGCAGCACCAGCAGCAGTACCCTTCTTCCTCGCACATGA
CGCCACTGAGCGGCCACCAGCAGCATCAGTACCAGCAGCAGCAGTCTATGATGGGCGGTGCACCCCCTTCGCGCAGCGCACCCGGGGGCTTCAGCGGTGG
CGGCAACAACAACCAAACGCGCGCGGGGCTCTACAATCAGATGCTCGAGCTCCAGATGGCGGCCGAGCGCGCGTACAACATGGCGAACCAGAACGCGTCG
TACCTGCACACCCAGCAGCGGTAGTGTACATGCAGCCAAGAGCAAGGCATGGAGAACGGAGAGTCTGTGCATGAAGCAGCAACTGATAGTTTATTAGAAG
ACGGAAGAGTGAGTGAGTGAGAGACTTGCGGACCTGGGCATCTGGGACTTGAGCTCTTGGAGAATAGCGCACGATAGGAGAAAAAGAGCGAGAGAGCTAC
GGTAGTTCTGTAATTAATTTGAATGTCAAGTATACATCCCCACACCGACATTGCTGTGGCCATAACATCAAAGCCATATATATGGCCGGGAAGATGTCCT
CTCTTCTGGTGATTCGCTCGTCGCTTTCGCAGAACGTAGTGAGGACATATTCGCCGTATATGGTGTTCTTCTTGCGGCGATGCGGCCCCGCCATGAAGTG
CGTGCTTCTTGCTTGATACGCTGGCCCCGAGAGCACGCGGAAGCGAGGAAAGTGGAAGCGGATCTTTCCGTGCGGGTAGTAATAGAGCAGCGCTGGCGCC
GTGTCCAGACGCACCGTTGAATTCAAATGCGCTGCAAACACGGATACTTTCAGTGTCGGGCACCTGACTTCGCCCACAAATCGCTCCTGTAGTAGTAAAT
GATCAAGTGAACACGCTCAGCCACTAACTCATGCAAGGCAAGAAGGCGCGATACGAGCAAGGCAGGGATCTTGCTGGCGAGACACGACAAATCAACCTGC
GGAAGGCGCTGGATCCATCCAAAGCAGTACAGCTCCGTGGCCAGTGCCACTGTGCGCTCCAAAAATTGATGACGATGACCACCTCCATCGTGCGCCGTGT
CTCCAGTGTTGTCAGGCTCGTCAAGAGCGTCTGGGACTGGCACATCATAGCGAAATGCCACGAACCGATCGTCGCGCACGCTACTGTTCGCCAACGGAAC
AATAATAGTTGTAGTAGGCTCAACGCGATGGTTGCTAGAGCTCGCGAGCTCCCACATGACGACCATCAGCGCGACGTAGAGGGTGCACACGAGCGACTTC
ATAACTGGTAGAGGCAGTTGTTTCAATGCGAGCCCAATAATGGATGCGCTCCTCCCATGATGGAAGGGTGCGACTCGAGATGGATGGGATTGTTGGGCCT
GGTGCCATATCTTTCTTCGACTGTGATCCAAGTGGTGGATCTTTGGAAAGGGTGTTACATTCCCGATCTCCCTGATTTAATATGACTCAAATTGGATAAA
GGTCATTTGTATGAAAAATGATAACCACACCATTTGATACACTTTATGGATCAAGTAGCTGTATTAAGGTGGACCACCTGACCTTGAAATTTCTGCTTGG
GGTGGGGTGGGAGTGTGTGCGCTTGCGCATTCAGCCACGCAAGACAAGAAATCGGATCCGCTCATCCCTCCTCCTCTTTTCTTCCAACACGCCGGTTTCT
CGTGCGAATTCCGCTGTATTTGAAGTGGAAATCCACGTCGCTGGCGTCTTGAGCCAAGGGCGTCGTGAATTTGTCTTGCCTTGTGCTCACAGCGCCTACA
ACCGTTCATTCGCTAGTGCAAACAATGGCTATGGTTTCTCCTCGTCTCAAACAAAATTGGATCCAGCTTCTGGTGTCGGAGGGAACTTGCGAGAATCAAA
TCTGCAGTGAGATGCTCAGTAACCAGAGCCACATGCCACGCACCTTTATCCAGCATTTTGTCATTGGGATGTGCTTCCCAGCTCACATCGCGTTCTGGCG
TCTGCACACAGCAAAACGCGACGCTTTCCAGACCACTCAATTCCGGGCGACTCACAGTTGGTACTATTGAACCCCGCGCATAATCCACGAAAACGCATTC
TCTCGCGGAGGGGGGAGTGTTGTTGTTGCTTAGTGGATCCTGCGTGTTATTTCTCAATTGAATCAAGTTCCTCTGTCGATTCTCTATAATATAAACATGA
GCACGTAGGAACACATTTCAAAACCGACTCTTGTAATAACAGAAAGGAGTATCACTTCGATTTTTGAGCTATGTTTTCTTAAATATGAAATGCAATAGAA
TAGACTTGACACCTGCGATTCCCGCTGTATGACAAGTAAGAACCATCCTTGTTGCTGTTTGCCCAATCAGAGTGACCCGCCCATCTCGCTACCGAAATTA
CCCTCTGACAATTTATATCGATGTCTAATTCTTGTGGTGCTTGGTGGCAACATTTCAAAAGCATTCACGTCCGAATCACAGCACCAACATCTCGAAACAG
ATATTGTCTTAAATTGCCGAAGCCCGGTGGGCTCCACTGAGCACAACGCACAACCAGTAGCAGGCAATGCTTGTAGTAACGATGCAGTCGGCATTGCAAC
CACCTGCAATGCGCTTGACGATAAGCCAACCATTACTTTGACGTGATCGAAATTGCAGGGCCCAACGTGTCGTGTTGTTTTGTTGGCAGGTTTTCCGATG
GTGCATCCCATCCCCCTTTTTAAACGCACCAAACCTCTATAAATTTGTACCTACATTGGCACAGAGAAAGTACACTGTCGAGCTTTCCAGCTGCTCGGCC
CCGCAATTCATTCGGCAAAAGAATTGGCGGAGAATTGACAAGTGGGCGGGAATTGCGCAATTGCGAGCAATTCTTCTGAAGTTTGCAACGCGTGGTGGAT
CTTAAATCACGGCTTCCAAATGAATCGTGGTTTCTTCCTTCAGCAGCATTTCCATTTACTGACCAGAAATGAGCATATGTCCCTCACATTCTAATGTTTA
TAGTCAATAAGAGAGACAAAGATTAGAAACTGAAACGCAAAGATCAATTAACCGATCCCTACAAATTGAATTGCGACTGCTTCGCTATTGTTTTGTATCG
GGACCACATCCGCATCATTCCTATATTAACTCTATCGACAAAAAATTGCACAAACACAAAACTGAACCTGCGGAAACCAAAGCCTTAGGAGCACTCATTT
CCCATTTTGACCAGGCGGCGGCACAAGCGACCCACCAAGCAAGCAAGCAAGCACGCAACCGCGCGCGCATTCGACTTGAAGCCACTTCTCGCAGCGTTAG
TGACGTGCACCCACCCATCCATTCATCCATTTGTGTGTGTGCCTCTTTGATCTGCTCGTCGTCGTCGCCATCATCTTCAACCTCCGCGTTCCGTTTTCTG
TGACGTGTTGAAGAAGAAGACCGAAACGATCTTTGCGTTTACGTCTGCGAAAGCACTCCGTACGTTAACAGTCTAGTATTACCATGCAGTCGACGCTTCG
TTCGAATGTGGCGCGTCTTGGACGCCGTCAAGCCTCCTCCTCCACCACCACCACCGCTACGTCCGCACGTCGTGGATACGCTAGCGCGGTGAACACCAAG
GAGCAGGAGGAAGTGTTTGAGAAGCGCGATGGATCCATGGGCAAGATCATCAGCGAGCGCGCGTTCATTGAGTTCAAGCGCCAGCCAGACCCGTACCGTC
CGACGCTGGAGCGACTACACGACTGGAACGAGATCAATACGGACACGCGCGAGCCGGTGGAGCGCAAGATCCAGGCTGCGCGCTGCATGGACTGTGGCAC
GCCGTTCTGCCAGACCAACACGGGTTGCCCTGTGAATAACTTGATCCCCGAGTGGAACGAGCTGGTGTTCCGCGACGAATGGAAGGAAGCCATCGATCGA
TTGCACAAGACCAACAACTTTCCCGAGTTCACGGGTCGCGTGTGCCCTGCGCCGTGCGAGAGCGGCTGCGTCGCTGGACTCGTCGACGATCCGATCACCA
TCAAGAACAACGAGTACGCGATCGTCGACCGTGCGTTTGAGGAAGGCTGGATCGTGCCGCGCATCCCGCGTCGCAACGGTCTTCGTGTTGCCATTGTGGG
CTCGGGTCCAGCTGGTCTCGCTGCTGCGGATCAGCTGAATCAGAAGGGTTACCACGTGACTGTGTACGAGCGTGAAGACCGCGTCGGCGGTCTACTCATG
TACGGTATTCCAAACATGAAGCTGGAAAAGAAGACTGTGAACCGACGAGTGGACTTGCTGCGCGAGGAGGGTATCGAGTTCGTCACGAACGCTGAAATCG
GTGTCACCATGCCGATCGAGCAGCTTCAGAGCGAGAATGACGCCGTGGTGCTGTGCCTCGGCTCGACGGTGCCTCGTGACATGGACATCCCCGGCCGCGA
GCTGAAGGGCATCCACTTTGCAATGGAGTTTTTGACGAAGAACCAGAAGCGACTGATGCTCACGATCGACGGGAAGCTGCAGAGCGGATGGGACCGCAAC
TTCATCACAGCGGAAGGCAAGGACGTCGTCGTGATCGGCGGTGGTGATACCGGCACGGATTGCAGTAAGTACCTCTCATTGTGTGATGCTTATTATGACT
GTATGTTTTGTAGCACATGGATTTTTCGTATGGGTATCTAACTTTCGTTTGACTCGCTTTTGCAGTTGCTACGTCGATGCGCCACCGCTGCAAGTCAGTT
ACGAACCTCGAATTAAACCCACAGCCGCCACCGTCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCATCTACGGCGTCGACTA
CGGCCACGCGGAAGTACGCTCGGTGTTTGGCGAGGACCCGCGCAAGTACAGCAAGTTCACGAAGGAATTCAAGGGCAATGACAAGGGCGAGATCACGCAC
GTGGTCACGCAGCTGTCGGAGCGCAACCCAGAGACGGGCATGTTCAAGCCGGTGGAAGGCAGCGAAGAGGAGTTGCCGTGCGACCTGGTGCTGCTGTCGA
TGGGGTTTCTCAACCCGGAGCAGAAGCTCGCGGAGCAGCTGAGCCTGGAGATCGACCAGCGCCGTAACATTCGCGCCGCGTACGGAGACTTCCAGACGTC
TCAGGAGGGCGTGTTCGCCGCGGGCGATTGCCGAAGAGGCCAGTCGCTCGTCGTCTGGGCGATCAATGAAGGTCGCGGCGTCGCGGACGCTGTCGAGAAG
TACTTCTTGGCGGAGGGATTCCAGCCGGAGGTCTCGCAGAACCAGCGTTTCGGCTAAGCTACAGTAGAGAAGGGAATGTGAGAGCGAGTGTCAAGGGTGT
GTCAACGTGTCAAAGAGGACGAAGATGGTGTAGTGCTAGACAAGGAGAACGAAGAACGAACAAGGTGGTGAACGAGAAAGGTATAATTTGAAACATGTTT
TATTGGGGAAATCAATGTGGTATTTGGCGAGTGATTGGCAATATGTAGTGATGATGGTGATTAGCAAAACTGACTGAGAAAGCAAAATTGTGTGGCTGGA
CTGCTGTAATCGAGTCGGGTGAGGATGAATGGCTGGCAGAGTTCCTACAGTTTGAGGATGGGCACGACCTGCAGCAACTCGTCGATGCCTTCGAGTCGCG
ATTTCTTCTCAGCATCTCGAGTCTTCTTAGAGCCGCTGTTGGTGCTGGTGCTGCTGTTGTAGCGCAGGTCCAGAATGCGAACGCCTTTGAGCATCGAGAC
ATCACAGAGACGCTTGCAGTCGCTGAGGTTGAGCACGTGGACTCGCGCAAGAGCGGAGACGTCTTCGATCAACTCACAGCCCGACAGGTTGAGTGAGTGC
AC