Description :
From Genome Similarity Track
Location :
contig_83:28812- 32120
Transcript NameFunction/comments
g10390.t1hypothetical protein

Sequence
3308 bases(100 bases per row)
AAGTCTCGCAATACTCGAGCTTCACTTCACCGCGTTTCACTTCGTCGCGGATGTGGTGGTACTTGATGTCGATGTGCTTGGCGCGGCCGTGGTTCACCGG
GTTCTTGGTCATCTTGATGCACGACTGGTTGTCTTCGCGGATCATGAGCTCGGGTCCCGTGTCGTTGGCAGCCGCCAGAATCTCGCAGCAGCAGAGCGAT
GGATCCACTTGCCCTCTTGGATAGCCAGACTGAGCGCGATGTACTCCGCCTCGCTCGTGGACAGCGACACACTTGACTGCTTCTTGCTTCCCCAGCTCAC
AGGCGCACTCATCAGCATGAACGTGTAGCCTGAGTGACTTGCGGTCCGCGAGGTCGCCGGCCCAATCCGCGTCCGAGTAGCCACGAAAGTCGATGTTGTC
GCCGGCTTGAAGCAGATGCCATGCGTCTTGGTGCCTTGCAGGTAGCGAAAGATGCGCTTGACCGCAACCCAGTGTTCTCTTGGGGTTCTCCATGAAGCGC
GACACATAGCCAACGGCGTACGCGATGTCCGGGCGCGTGGCGGTCATCAGGTGCATCAGCGCACCAACAGCTTCGCGAAACGGAGCGTTCACCTTGGTCG
CCGCGTCGCTTGGAACCAGTCGAGTGCTCATGTCCACGGACTCACCACAGCCTTGCACTCGTCCATGGCGAAGCGTTTCAGGATGTCGTCCACGTAGCGA
CGCTGGCACATGGTCACCGCTGCCGTCCGGCCGTCCACCAGCTCGATCCCAAGAACAACGCGCACTTGCCGCTGTCGGTCATCTCGAAGCGCGTCTTCAG
GTCCGTCTCGTGCGTGCGATCAGCTCGGGCGAACTCCCGGTAATCAGCACGTCGTCCACGTACACCAGCACGAGCACGCAGTGACCGTTCACCACCTTGA
TGTAAGAGGCACGGATCGAAGGCCGACACTTGGAAGCCGATAGAGCACATGAACTCGTCGAAGGTCTCGTTCCACACGCGCGAAGTTTGCTTGAGACCGT
AATGGCCTTCACCAGTTCCAGGCAGTCGAAGTCACCATCCAGTTCGACGCCTTCGGGAACCACGCAGAACACCACCTCCTTCATGACCCCGTACAGGAAC
GCTGTCACGACGTCGAGTTGGTCGAGAGGCCAGCCGAAGTACTTGGCGATCGCGATGATCATGCGCAGCGTCAAGTACTTGACCACGGGCGAGAACGTCT
CCGTGTAGTCGATGCCGTACTTCTGCTTGAAGCCCTTGGCCACGAGGCGCGCCTTGTACTTCTCGATCGAGCCGTCCGCTTTGCGCTTGATCTTGAACAC
CCACTTGGTGCCGATGGCGCGCTGGCCGCTGGGCAACTTGGCAGCTCGAAACACACCACGCAGTCGCATCGACTTGAGCTCCGCGCGGATCGCCTTGCGC
CAGTGCACTTGATCCGGACCGTTCACAGCCTCTTGGAACGTCGTCGGCTCCGATAGATCGGCTGCTGCTTCACAGCGTTGGCACTGGCACGCCAAAACAC
TGGAGGCGTCGATCGTCGTCTTCATCTTGGTCCCCAGACTTTTCTTCTTCGTCGGGTTCAGCTCGGCGCGACGAGGATACGTCCGGCGCACTTGCTTCTT
CTAAGCCAGCCGGTGGCGAACGAGGCGCGATCTTCTGGCAGTGTCGTCGTCGCCACTCGGTCGGCTCTTGCGCTTCCCGCCTGCTTGAAGCTCGTTTGGC
GCGGTCCATCGTTGCCGTCCAGGTCGAGCGCGTCCAGGTCCAGCGCAGCATCATCGACGTCTTCATCCGAAGTATGCGCCGAAAGTCCAAAGGCCGACTC
ATCGAAGTTGACATCGCGACTGACAACCACCTGCCCCGCCTCGATGTCATAAAGTCGATACGCCTTGGACACTTCTTCGTAGCCGAGGAACAACCCGGCG
CGAGCCTTGGGGTCCCACTTGCGCCGCTTTTCCTTCGGCGTCAGGATGTACGTCTGGCATCCGAACACACGCATGTGCTTCACACTTGGCTTGGACTTGT
ACACGATCTCGAATGGAGTCTTGTGCTCCACCTTGGGTGACGGCAGGCGGTTCTTCACGTAGATGGCCGTCATGGCCGCCTCAGCCCAGAAACACTTGTC
CAACTTGGCGTGATGCAGCATGCTGCGGCCGATCGTGACGATGGTCCGGATGGCGCGTTCTGCCGTGCCGTTGGTCTGGTGCGCGTACGGAACCGTGGTT
TGCTGCTCGATGCCTTCGACTTCGTAGAAGGCCTTGAGCGAGTTGGTCGCGAACTCACGAGCTCCGTCGTGCCGCACAAACTTGACCTTCTTGCCGAACT
GCGTCTGCACCTTCGTGACGTACGTCTTGATGCAGTCTTCGCTCTCCGACTTGGCACGCAGGCAGAACCCCTTCATGCATCCGCTGGCTTCGTCCACGAT
CAGCAGCAGATACTTGCTGCCACCCAGTGACTCTTCTTCCATGGGGCCGCAGATGTCGAAGTGGAGCAGCTCGAACGTGTCGTAGCGACGCTTGTCACGG
TTGCTTGGGAACGGCTTCTGGACCATTTTCCCTTGCTGGCAGCCGCGACACACGCTTGGTCCACTCGACTTGGAAGGTGCCTTCGCGTCCTTGATCATGT
CGTTGTCGACCATCTTGCGAAGCACCTCCACCGGAGCGTGACCCATACGCGCGTGCAGGTCGACCGTCTTCCCACTGGTCGCCGCATTCGCCGATCGCTG
AGGCGTCTGGAGCCAGTAGAGGCCATCCACGAGGTTCGCCGCCGCCACCACTTGCTTGGAGGCCTTGTGCGCAACGCGCATCTGGGTGCCGTCGAACACG
ACTTGGAACAGACCACTCTTGTTGATCTGTGGCACGGAGAGCAGATTCTTGCTCATGCTCGGCACGTACAGCGCGTTCTTGATCTCGATGTCGCGCTCGT
CGCCGTTGGGCAGAACCACTCGTTCCACGATGGTCCCCACACCCATGATGGCCGCCTTGTTGCCGTCGGCCACCGAAAGTTCGCCCTCGTTTCGCTCAAT
CAAATGGGCGAACTTGGCCTTGTCGTTGCAGATGTGGTGCGTTGCGCCGCTGTCGACCGCCCACATGCCGAGCATATCCTTGCCCGTCGAAATGCCACAC
TCCAGTGAGACCGCGAACGCCACTCGATCATAGCCGTAGCCGTAGTCGTAGCTGGCGTCGTCGTTCCTCCACTGGGCATTGTTGGCCCCGCGTCCACGGC
CATTGCCATTGCCGCCGCGTCTTGGGCCCCGATTCTCGTCCTTCTGCTTGGTCCAGCACTTGTCGATGGTGCCCCAATTTCCCGCAGTACGTGCACTGGC
GAGACTCT