Description :
From Genome Similarity Track
Location :
Scaffold_2048:288- 3256
Sequence
2968 bases(100 bases per row)
CCGGGTTTAGAATTCCGGTTACGAGCCCGAGGCTTTCTTAGTTATTGCATTTATGCATTTTTGCTTTTGAAACAAGAACATCGCTAGATCCGGGTAGCAG
GACCCCTAGAATCCAGCCGAATAATACACGTGATCTACATGAAGTGTCAGTTATCGAGGTTTCTAGTTTTGCGCCAAATGGATGAATTTCCAGATCCAAA
GTCTCTTCAACCCTGGATTTACAAAGGAGAGAGGCACGTGGTTATTGGGAGAAGCGCCAACATGGTCGATGGTTTGAGCCTACCAAGGGTGAGGTCACTG
CAGATCCACCTAAGGTCTGTCAGGTCACTGGATCCCGTGGATCTGAGGATGTTGGATCCTTGGATCTGCTAACCGGGGAGTCCCGTGGATACTGGAAGTA
CCATGCACCAGGAAAATGGTTCAGACAAGCCAAGGTAGGGGGCAAGATCAACAATGAAAAAGCAATCCTACTTCTAGATAGTGGTGCCGAGGTGTCTATA
CTAGATACCACCTTTGCTCGTAAGGTTGGGTGCCAAGTGGATGGGAGTCGGATCCAAGATTGTGTTGGGATTGGTGAAGGCGTGTACCGTACGAACGGGA
GAACACGGATCAAGATCACGTTGGCAGGTTGTTTGGTATATTGGTTCGGTATTTGGGTCGGAGACCTCGCTGGTCAAGATGCCATCCTCGGGATGGATTT
CATGGTACCAGCCGGGGTAAGGTTGGATCTGGCAGATGGGACACTGTGTTTCCCGGACGAGATGCGGATCCAGCTCAGCGGACGGCGACCGTTGTATGGA
GCGAAGATGAGGATCATAAGGGCGGATAAGACAACCTGGATCGAGCCCGGGGAACCTGGGAGCTGCCAGACCGGTTAAAGTGGGTGGAACATGAGAAACT
GTGGGTCACTCGGGGCGAGAAATGGGTGCCTACCGTAATCCAGGGGCCAGGTCGATCACAATCCCTCCAGGTCACGAGCGTCAGCGATAAGAGACTATTA
CTGGACCATTATGAGGAGATCGGGCGATGGTTGGCGAAGGATAATATCCCTAGGCGACCTGGATATGTATCAGTGGGATCCCGTCGCTATAGAAAATGGC
AAAATCTGGCGTATGAAGCGACTGCCGAGACAGAATCCCTCGGGGAGGTGGAGCTCCCGGCGGAGCCAGCTGGCCCCTTGGTGGATCGGCCTTCATACCC
AACTCCGCGAAAGATCCTGCAGAGGGATCGTCGGATTGGGATCCAAGTGGTAGAAGTTGGATCCAAGACAGCTGGAGAAACCCAGAACCGGTCCATATAT
ATCCAAGGATCGGTGGATGGGGGATTTCAGGGAGTTGAAGTCGGCTCGCGGGATCCTGCTGACCAAAAGTGGGATCCGAACTTTCCATTGGATAGGATGC
CCGGATTCCTGTCGAGAGTGTCAACACTGGCTAAGCAGGAGCCCGTCGTGTGTAAACTCATCAGAAGATCAAGTCGATCCAAAAGGTAGTTTCCCCGGTA
CCAGAATGCCCCGATCCCCATGAAGACAGAAGAAATGACAGGAGAGGGGGAATCGCGGTGTTTGGGATCCAGTGGTGGATCCGACAAAGGCTGAAGATGA
GCAAAATATGCTACTATGAAGGCGGAGATCTACACGCCGAGGATCTTGGGGAAGGTATGGCAGTAATCCCGGAGGTGCCACTGACCACAGAGGAAGTCAC
GATTGATGATATCCAAGTGGATCCGGGGGCGAACGAACCCGCGTAAGTGGGTCAGGAGATCTGGGAAAGCCGACATCTGCTAATTGGCAAAGGAAACGCA
TTACCACCCGCTGCACGCGGAGTCAAATGTGACATCGATGTTGGTGATGCGAAGCCAATCGCTCAAAGGGTGCGCAAGTTGGCGCCTCAGTTCCGAGAAA
TGCTCTGGGATCTGATCTAGGGTCTACTGCAAGCCAAAATCATCGGTGTCTCAACCTCCCCGTGGGCATCTCCTGTGGTAATCATCGTTAAGAAGAACGG
AGTGGATATACGTCTGTGTATTGATTACCGGATGGTTAACGGTCTGACCAGACGGATGGTGTATCCGATGCCTCTAATCAATGAGCTATTGGAAGATTTG
GATAAAGTACTCTGGTACTGTTTTCTAGATATGGCAAGTGGGTTTTAGGTGGTGACTATGACGGATCGAGCTCGCGCAATATCTGCATTCATCACACCAT
TTGGACTATTTGAATGGAGCCGGATGCCGTTTGGATTGAAGAATGCACCCATATCTATCAACGCCTGATCGATAATGCCCTCTACGAATTTACCCGAATA
TCGGAACCCGAAAGGGATGGATTTGGGGAAGGTCATGCGGAAGTGGGTCCATTCGAAGCAGGGGAGCCAGGTGATCTGGGAACCCCATCCGTGTTAAGGC
GCAGATCCTATATCGACGACATTCTAATCCCGGCGGAATCGTGGGATCAGCTGTGCGAGAGAGTGACATCCCTACTGAAGGCGTGTACTTAGTGGAATCT
CTCAATTAGCGTGGTATAGGGTTATTGAAAGATGCGGAAGGTGGATTATTTAGGTCATCGATTCTCCAAGGAAGGATAAGAGGCTAATCCTAAAGATCTG
GCTTCGTTGGCAGACTTGTCATTTCCACAGTCGCTACGGCGATGCAATTCTTCTTGGGCAGTTTGAGCTGCTACAGTCGGTTCATCGAGGATTACGCACT
TTTCGCTGCAGTCCTCTATGAATTGAGGGAAGTGGATTTTGCTGCGATGGCCACTTCGGCTGTCCGGATCAAGATCCAACAAGCTCTGGCCCTAGAGATC
CCCGATCCACGAGGGGATCCACATAGTATGACGCCGGAAGACGGCCTTAAACAGGAACTGGATCCATCACGGGACCAATTGGGAGAGGATCCAATCTGGA
CAGAGCTGACGGAGGGGAACTCGGAGAACGTGGAGCCTCGGTGGATCCGAGCTCAGCACGCGTTTGTG