Description :
From Genome Similarity Track
Location :
Scaffold_1623:288- 2621
Transcript NameFunction/comments
Phymu_g13486hypothetical protein PHYSODRAFT_354328

Sequence
2333 bases(100 bases per row)
GTTATGCCGTTGTGAAACCCGTAATTTCTGTCTCCAACGTCGCGTACAGCACAGCCTTGAGTTCCTCTCGAACCACGTGGAGCGGCAGGTCTAACCGGTT
GAAGCAGGCGTGACTGTGGATAAATCCGTCGCCTACAAGCGGAACAGACTTGAGAGAGAATGGACACAAACGGCCGTCGTAACTCGTGAGAGCAGCAAAG
CCACCCAACGGCACACGTGAAGAACCGGTAGCAAATTGCAATAACCGTCGACGATATTCATTTGGCATCTCACGGACCAGCTCCCAGAACCACTTGAGGG
ATCGATGGTGATGCAGCCCTTCCGAGTGCGTTGTGTGCTGCTCCCAGTCCTCCACGTCGATTTCTTCCGAGCCACAGAGCAGAAAGTCGAATTCCTCCGG
GtcaaagagcagcagcaactcgcgAGGGATTACCTCGTACAAGCCTTGGAGAAACACTTGCAGCTGGGGTGCCACACTCTCAACCAGTAAATACTGCCAC
CTGCGCTCGACATACTCGTGTTTGTTGCTGTCAACGACGGAGATGTCGGTTCCACCTGGTACGAGCTCTATCGTTCGGTAGCTTTCCCCATCCTTAACAG
TCATACTGAAATCGAGACCCAAAGACTCCACGTTGTCATTCTCCAGTAACCAAAGCAAGTTGGTGTACACCTCCGGGTCGAAGTCCTCCAGATCCGCAAA
ACTCAATGGATAACCCAAGATGAGCTTTAACAGCGGCGGCGCCAAATGGAAACACAGCATTGAGCCTTCCAGTAAAGCTCGGCCAAGTAGACGGCCGGCT
GCTGATAGGTGGAGTAGCTGGTGAGGACGTTCGTCGGGATCGGTGCAGGGGGTTAGGAAGTAGGTTTGCTCGCTCTGGTTAGCGCACACGAAAAGTCCTC
GAGCTGGATCCACGAGTATCTCGTTCAGCATCACGAACCACTCGCGCTGAAGGCCCCCAGCATCAATCCCACTTTCGTCCAGGAAGTTAATTCGCATCAC
AGAATGCAAATTCCGGAGAGGGATTAATGCGAGAGACTCCATTGAGTCCTGGAACACTGTAGCACGCTCAATATTGAGGCGTAGATGTTCTCTTTCGGCA
GGCACCAGCAGACTTGAAGCGGTCATGACGAAATGCGCATACTTTGAGGGAAAGTCTTTGCTGGCAAAAGACATCAACTCAGCCAAAGCTACCCCGTTTC
CATCTGCAGAGGACGATGTGTGTCGGACTGGGGCAATGGGGACTCGAAGAGGGAGGCTCAAAGCATCCACCCGGATATCCGACACTGGCATTAGCACTgc
cttcagctcctggacGTTGTTCTTCAAATTGGCCATGCACCCCTCAACTGAGCCAAACGTAGATTTTCGTTGAACGTGGCTACTTGAGACATCGCCACTT
TCATCTGGCCACGCTTGAGCTTTATCGCTGGGTGCTACCTCGGACGCCATGTTGTCTTTTTCCTGAGACGCGGAAAGTTGTCCAAGCAAGTTGTGCCCAG
TACTTGCAGGTTCAAACgaaacagcaaaagctgcaggcATAACATCGGTCTTCACGAAGCGGCTATCACGAAACCAGTACGCTCGCCCTTCGACGTCCAA
TTTGCGCATCCATTCTTTACGTCGCTGAGCCCGTATGCTGCGGCGAGAAGTTGGTTTCGAGCGTAGCGCTGTAGATGAGGAAGAGGTCAACTTgacgtgc
tgctcttgttTGAAGACGGTCGAGATCGATagaatcttcttcttctttgtagCTCCTGAGCCTTGTTGGTCACCGTTGCCCTCCGCGATTTCTTGCCCAC
AGATCGTACAGAACCGGAAACGCTTAAAGTTCTCGAACTCACACACAGGACACTTGTTGTATCCTTGCTCTGCATCCCTAGATGGAAACGACAACGACCA
ATGTCAGTCTTTGCAAATCCATGCACTACCAGCCAACCCGATAAGCTTATAAGGGAGACCGACCTCAGCGCCGCATCCAGACGTCGGTCCTCGGAACTGC
TAGACAGTGGAGCGGGCAATAACCGTTAGACACTTCAAGATACAGAGCTGGGTGATGGTTAGCGGTTATTTTGCCGGTACGCACTTGATTAGCGGCGCGT
TGAGCTCTGCCTCGCGCTCGAATTTCTTGAACGACCGTCGCGCCAGCCAAccgaagaagagagcgagaagaagccctAGCGCACACGCTGCGGCGATGGT
TCCGCCCACAGACATCGTTCACGTCTCGATGAGAAGGGCGAGCCAGGATGGCGAGTGCCACAGTGAGGCCCTCGCCATTGGGTTTTCTGGTTCTGCATTG
CTGATCAGGTGCTGCGTGCAGAAGTAGGGCGGT