Description :
From Genome Similarity Track
Location :
Scaffold_1764:288- 2590
Transcript NameFunction/comments
Phypl_g14101hypothetical protein
Phypl_g14102hypothetical protein

Sequence
2302 bases(100 bases per row)
GGTGGGAGCGGGTGTACGAGTTCGAGATGTGGATCATGAACCACACCGCAGGAGTGGATGTCGTACTCGGAACGGATTTCATGATACCAGCTGGTGTTCG
GCTGGATCTGTTCCATGGTACGGCAAGACTCCCTGACGAGGTCATGGTGCCACTGGTGAAGCCGCAAGGCATGGCGGACGAAGAACCGCATGGCGCGCAA
GTGGTCGGTGGACCGACCGAGGATCTGGATATCCCCACACGTGAGTGGCGAGAGTTTCGGCTGCAACGAAAACAGCCGTCTCTGAGCACCCATGATATGT
GGATACGACGGACAGCGAAGGTGGTCCCGACTGTGACGACGTTTCGCCGTGGGCAACCGACGTGGGTCCGACTTACGATTGTGTCACCGAGGGATGATCT
ATGCGCTCGGCACGAACCAGTCGTTCTGTGGGTGACATTCCTCGTGAGGTTGGGTATGCTCGGCTCAAGTCCCGGAAGTACAAGGACTGGCAAGTCCTCG
CCTACGCTGAGAGTCGGGACAAGGCTCTGTTCGATCGCGAACGGGAACTCTATGAACGCTGGCTGGCGGACCAACCCCCAGCAGTCGAGCGCCGAGCGTA
CCCGACACCCCGCCGGATTCTCGGCAGGGGACCCGAGGGCTCGGACGTACCAGAAGAGGGTCGTCTGGCGCACGCCGAGCGAGAGAACTGTTTGACCGAA
CCGGGCGATGGATTTCCGATTGAGGAAGACAGCCAAGTTTCGGAGATAGCCgacatcgacagcagctgtAGTGGGGCCGCCAGTCACATACTGACCGATG
ATTCTGACGAACCGGAAACATCCGACACGGGACCAAGTACAAGGGGCACGCCTCTCGGTGACCTGACCGATGAGTCCGGCTCTTTGCTGGACGCTGCGTA
TGTGTGGGAAATGCGCGAGATcgcggctggagctgttTCGGGACGTAAAGATGAAAATACAGACGCGTCCGAGCACCCAGCGAACGAGATTGAGCTGACC
GACtacgtgcaggagctggatTTCTTGCCTGATCTGACCGAAGTCTCGGAGACGACTTTGGATTACGCCGGACCGAACGTCCGGAACCAAGAGGCTGATG
ATAGTCAGCAGCGGGACCTCGTTGGNGACCGAACGTCCGGAACCAAGAGGCTGATGATAGTCAGCAGCGGGACCTCGTTGATGTGTTGAAACGTCACGCG
GGGATCATGATTTCGAGTGGGAGTGCTCTGCCGCCACCTGCGTACGGCGTGGTATGCGATATCGACGTGCAGCGAAACCCACCGATTAAGCAGAGGGCTC
GGAGGACCCGCTCCGCCATCTTCggaagctgtacgagcttCTGAAGGGGTTGTTGAAGGCTGACCTGATCGCGTTCTCGGACAGCCCATGGGCGTCGCCG
ATTGTGATTGTCCTCAAGAAAAACGGCGTGGATATCCGTTTATGCATTGATTACAAGATGCTAAACGCGGTGACCGCGATCATGGAATACGCTATGCCGC
TGGTGGATGATTTGTTGACCGATATGGAGGCCTACCTATGGTTCTGCTCCTTGGATGTAGCCAGCGGATTCTGGGCCATTATGGTGACCATGAGAGCTCA
GAAGGTGTGACGGGGGTCACACGCACCTTGGCTTGAGGAAGCGTAGCTTCTAACCGGACAGACGCCTGGCGTCTCTGTCGTCTTGTTCGCACGAGGAGGC
CCTGCCTTCCTATGGCTTCTGGTTCATGGAACCAAAGCCTTGCGATTGTCGAGGTTAGATTTAAACTGAGTGTATTTACTGTCACACTCTAGTCTCTAGT
TACCATAACTACCTGAATAGTGAGCCGTCCTTTAATGACGACAGCCTAATGAATGGCTCAGACCTAACCTACTGATATAGGTTAAGGGAAGCATACTTAG
TGACGTCCAATGTGGTGCACCCCAACTTATGTGGCACACCACATTCGTGTGCCACATCTCATTTGTGTGGCACACCTCATTTGTGTGGACCACGTTAGAA
TCACATTCAAACCGTCAGCCATCCGATGGCGACTGACGCGGCGCGGCGTGGCGCGCCCCGTTACACCCTCCCACACCCAAACGAGAAGCACCCGTCCCAG
GGGGAATCCAGCGAAACGCGTGCACCACGTGCCGACCCAGCAAATGCGGTCTCATTCTGCAAAACGCCAGCCCAATGGGCACCGCCGAGCCAGCTGCACC
GCCTCAAGCCCCCTCGCCCAGCGAGAACGCCTCGATCGACCCCACGCCTGGGAATGGCCCTAAGGGTCATGCGATCTCCACGAAGGCGGCCGATTCGGCA
AC