Description :
From Genome Similarity Track
Location :
Scaffold_4568:288- 1755
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_4568-fgenesh-gene-0.0Glycoside hydrolase

Sequence
1467 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCCACGGCCTCAGGAAGCGCTGTGGACG
GCGTGATCCTCGTGCGTGGGAACAAGATGTACAACGCCAAGACGGGCGCGCGTTTCTTCATCAAGGGCGTACGTGAGGAGCTCCTGGATATCTAATGGGT
ATCTCCTCACTGACCGGGAACTGCATTGTGTCTGTGTAGATGACGTACGAGTACGCCGTGGACGACGAGCACTACACCAAGTACTCCAAGGCCGTGATCG
CTGATCAACTCGGCGACATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNGCGGCACGCCCGACAACAGCGACTACTGGACCAAGTACCGCTACGCGACCCTGAAGAAGGGTACGGGCCCGGACGAGGGCGAGACGTGCTACTCGCCC
GTGCTGCTCGAGTACGGCNNNNNNNNNNNNNNNNNNNNNNNNAGGTGGCCAAGAACTTTGCGCAGTTTGACAACACGCTCGCCATTCTCATTGGCAACGA
AGTCATGCAAAAGGACCTGACGGCCGGCGCGTGCGTCAAGCAGTACACGGCCGACCTCAAGACGTGGATGCGCGTCAACGCCAAGAAGCTGCGCACGCTG
CCGATCGCGTACGCGGCCGCCGACAGCGCGTACGGCACCAAGATCCCGAGCGCCGAAGAGTACCACACGCTTAAGATCCAGGGTCTGCTCTGCGGCGACA
AGATGCAGGACGGCGTCACGACGCGCAGCATCGACATCTACCTCATCAACGAGTACCGCTGGTGCCCCGGCCGTGAGTTTGCCGTGTGGCAGAACTTTGA
GGCCATGGCGCAGGGCCTGCCTATTGTCATTGGCTTTGGCGAGTACGGCTGCAAGCTCAGCACGCCGCGCGACTGGAAGATGGTGCCGTACCTATACGAC
GAGCCGGCCAAGACCTCGGGCTTCTCGGCCACGTTTTCAGGCGGACTCGCGTACTCGTTTGGCGAGGCCAAGCTCGCGCCCGGGTCGCTCTTCCCCATGT
TCACGGGCGGCTCCATGGACCCGCTGGGCAAGCCGAGCAACGTCGCGACCGCCGACTTTACGAACCTCAAGGACCAGTTCGCGGCCCACAAGCCGTACGC
CGAGCCGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGACCGCGGACACCAAGTGCAAGTGGGCGCCCGACCTCA
GTACCAAGATCGCCGCGACCAACAAGCGCGCGACCACGAGCGGCTGGATCGTCGCCGACTGTGAGGCCGCAGCACTCAAGGTCGCGGACAGCGACACGTG
GGTGACCAAGTCACGCCAGGGACTCGACTGTAAGAGCGGCGACGACTGCGATGTGCCACTCAAGGAC