Description :
From Genome Similarity Track
Location :
Scaffold_3446:288- 1689
Transcript NameFunction/comments
Phypl_g15839hypothetical protein

Sequence
1401 bases(100 bases per row)
GATGACTGTTGACCGATATGGAGGCCTACCTAGGGTTCTGTTCCTTGGATGCAGCCAGCGGATTCTGGGCCATCATGATGACCATGAGTGCTCGGAAGGC
ATCCGCCTTCGTGTGCGCACTAGGGCACTCCGAGTGGTTACGAATGCCGTTCGGGCTCAAGAAAGCGCCGATGATTTATCAGCGGATGATCGACAACGCT
CTGTGGGGTTTCGTCCAACTGAAAGGcggatggctacacttcTCGGAGCTCATGCGAGCcgctgaggaggaagacaaTGCCGCTCGGACAGGGGTGACTA
AGGGCTCTCCTATGCTAATCGACGATCCAACAGTCTGTCCGACCAAGTTCGAGGCCGACCGAGCATCCTCGACCAACATGGATACCGTCGCCTTGCTCGT
GAACAGCCGGATTGCGGACATGTTCGCTAATGGCGAGCCCGACGAATCCTCGTTGGTGCCCGTGTTCGATCGACGATCGTTTGTGGATGATATTTGCTTC
GGCTCAGAGACGTTTGATGCGTGTTTAGCGActctcgaccagctgcttcagcgctTTACGGAGTGTCGGATCAGTGTTAGCTTCACGAAGAGCATCTTCG
TCCAGTCACGGGTGGATTTCCTGTCGCACGAGGTATCGTCCGAGGGTATACGAGCCGATTCCAAGAAGGTCCAGGCCGTGTCAGAACTGCCGTTCCCGAC
GTCGAAGAAAGGAATGCAGTCGTTCCCTGGGGCGCTCAGCTATTACAGCCGTTTCATCCAGGACTTTGCTGTGTATGGAGCTGCTCTGTACCAGCTGAAA
GACGAAGCTTTNTGCAACAGAGGGTTATGGCCGCACCGATACTGCGGCACTTCGACCGAGACAAGGCACTACATGTCATACTATTTGCGAACGAGTGGAC
TCTGAGTTCCATGTTGATGCAAGAGCACGACGAACTATTGCATCCAGTCCGGTTCTGTGGCCGCGTATTGAAGGATGCTGAGCTGAATTACCATCCagcc
gagaaggaggtgctaGCTCTTCTCTTACTGTTGAAGGTCTGCTACACTCAGCTGGCCGGCCGAACGATTCACGCCTATACGCTATTCTCGACGCTAGATT
GGCTACACAAGTCAAGACATAGTTCGGTAGGGCGACCCagtttgcagtgctgctcTGCCTGTGAGATCTGCTGGTGCAACGTGTGAAGGAGAAGGATTGT
GCGTTTGCTCAACTCCTGCAAGCGGGTCTAACGAACTTCGTCAAGCTTGAGGACTCACTCGCTTTGGTTGCTCCGCTGACTAAAGGGTCACCGACCACTC
GGATGGATCCACGTTTGCTCTATGCGCGTCTACCGAGATCGTACAGAGGCTTCGTGGTTTCTTTCGATGGCTCCGCGAagaccgagaagaacggTGGCTA
C