Description :
From Genome Similarity Track
Location :
Scaffold_3347:288- 1611
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_3347-snap-gene-0.1Adenylate cyclase

Sequence
1323 bases(100 bases per row)
TCGGTCCCGTCGGAAACGGTCGCCAATCTTCGTCGAGATGAGTTCATAGAGTTGGAACGAGATGCCAAGATCCATGCGCTCGAAGAGATCAAACGGCTGT
TTGCTGAACGCGCCGTGCACTTTGTCTTCCGAAAGAATAGCTCTCTCGTCTTCGTAGATCGCCAATGCCGACTCACTGATCAGGATCTGACCGCCTTTCC
CCATGTCGCCCAACTCGCGCGCGACGGTCTCACTCATACCAAGGTACGTCATCTTGCCGGTCGTTGGATGCTTGGAACAGATCAGTTGCTCGTCGCCATC
GTGGATCGCCATGCGCACACGCAGTCCGTTGAACAGCAGGTGGCCCCAGATATCATAGCACCGTGCCGCATGTGGCGTCTTTAGAATCGACGGTGGCCAG
TCCACTTTCAGCAGCTTCGATTGAACGTGCATACAATATTGAATCGCGTCCGATACTGTGTGGAACGCCAATTGAAAAGCGTCACCTGCCGTTGTGATCT
CGTAGCCATTGCAGCGAAGCAATTCTTTGCGCATAAGGTCGTCGTGAAGCGAGAGCGCGTCGGACATGGCCTGCGTGTTGGTTGNNNNNNNNNNCCACAG
CGACGTCGAGCCTTCGATGTCGGTGTTGACAAAGATTGGGCGGTACATTGGCGGCTCCACGATANNNNNNNNNNGCTCCAGCTCTTCTGGAAAGTACCCT
TTTTCCAGGAGCTGTTCGTAGACGGACGGAGGCATGACGGGGCGCAATGTACGGTAGCAGCAGGTGACACTCGTGCCAATCACCAGCGCGGAAGCACCAC
CGGATAAATAATACAGCGCTTGGCTGAGACCAATCCAGATGATCGGCACGTCTATGACTCGATTCAGCAATTCCACGAGACATGATGGAAACACGAGCAC
GCAGTACACGATGACCAGGTTTCGAATGCGTCGATGCAGGAATCTCGATGTCGGAGGTACAACTTTCTTCGTTCGCTTCTTTAATGACAAGAATAACGTA
CAGCCGAGAGGGTACAGGAATGAGACCCAGACACACACCAACTGGAACGTGAGCGCAATATCACGCACGGTGCGCTCCTGCTGGGGAGACAGCAGCGCCG
ATATGATCATGAGCGCCGCGAACAAGAAGGCGATACCGTATGTTCGAACGCAATACACGTGCACGATGTGACTCTCCATCGCGCGGCCTCGATCCATGGA
TTTCGCGATTAGACGCGCCATCTCGTACGCCAGCAAGATGACCCAGAAAGTCATGCATAGGAGCGCAACGTCCCCGATAAGCGCCAACAACACCACCATG
GATTTGCCGCTGCTCGTTTCGTC