Description :
From Genome Similarity Track
Location :
contig_5:287925- 289404
Sequence
1479 bases(100 bases per row)
AGCTTGAACTGCAGTAGCACCATGACAATGCGTAAGGACGGCTCCTTTTCACCCGCAAGGTGATAGTAAAGCGTAGCTCGCTCTGGCGAAATGAACGACA
CCCCGAGACCATGCTCGTGCATGTACCCCACACTGAAAAGCGCTCGCGCGCTTGTGCCAGCACTCACCAGGTCTGCATGTTGATAGTGCCTTAGCGCAAC
AGTATAGTCTTCATCTTGGTAAGCACTGTCACCCATACGCAACAGCGCGTCAATGCTGTCTTGCTCAAAGGCACGATTCACAAGTCGAGCATATAAGCGT
TCAAGCAGCTTTGAGTCACGGATAGAGGGAGTGCCAAATACTTGTCGCTGAACACGTTCAATCAGCCAGACAGCATTGTTCTGCGCGACTTCATAACCCA
TTTCAGCAGCAATCAAGTACAGCTCCAGCGCTAGCGCCCAGTTGCCTCGTTGCGCGTGGGTCAGCGCTTGTGTCATCAATGTTGTTCCTTCTCGTGAGTA
TTCGGCCACGCGCTTATAGAGCTCAACAACTTCTTGACACGATGTACTGCTCGTGGTTGCACCTCCAATGGTGTGAATCTGCCGCTGCTTGAGTCGAGCA
AGCTGGAAAAGCGACTTGAGATGGCCAACGTGTGCCGCCGCAACGAATACTCTTTTGCCCGTGACGAAAGGTGAGACCCGAGCTCCAAGAAAGACATGCC
CGTATTGTAGACACCTTCGGCATGACCTGCGTTAGCTGCAACTTTGAAAAGGTGCGAGCTCTGTCAGGATCGACAGGCATGTCACCAATGCCGCGCGAGA
AAATAACACCGAGGCCATTTGCTGCTTCACCGCTAGGATTTCCTTCCGATGCGTTCAATGCAGCTTCGTAGAGCTCTACAGCTCGTGAGGCGTTGGATTT
GCACCCTGCAAGTCCGTAGGCGTACACGTGACCGAGAAGAGCCTGAGCCTTGATGCTGCCCATTTCAATTGAGCGCTCCAGAAATCGTAGTGCCTCACGT
TCACGAGCAGCGTGTTCTTCAAGATCAGACATAGCTGTAACACCGTACAGGTCGCTGAACAAGGTGATGCTAGCCGACTGAACCATCACGTCGGTGTTGC
GGAGGTCAGCAGCACGCTGTCTAAGATACTCAGCTCTGTTGAAGTCTTCTGCCGGGTTGAGATCGCCATGATATCGGGCACCCTCGGTCTCGGAAAGCCT
TGCAGGTTCAGGAAAGGCATACAGCTGAAGCTTCTGGTCATTCTGCTGGGTAACGACTCGATCCGCGGCGAACTTGTAGTGCCTCATAGCTGCCGTACAG
GACTTCCTTGAGCCGTAGCCGTGTAAGGCGCGATAACCAAGCGCCATGGAAGCACCGATCGATTGTCCACGAGTAGCAAACGCGTAGTATAATTGAGCAC
CTGCACTGTCATCAGAGGCAGCTCGCAGAGCACCTAGGAGGAACTGTGCTTGGGAACTGCCGTGCCCAGCACTAGCTTG