Description :
From Genome Similarity Track
Location :
contig_57:287923- 289467
Transcript NameFunction/comments
g8930.t1hypothetical protein PHYSODRAFT_563428

Sequence
1544 bases(100 bases per row)
TTAGTTGGCCGCGCTGACGTTGTAGTACACCGTGTTCTCGAACTCCGGCGCACAGTACGGGAACTCCGTTTCGTCGTGTGACGGAGCAAACAGCTCCTTG
CCATTCATGTACGTCACGTAGCAGCCCAGCACAAAGCAGATCACCACCACGATGCTTCCCGAGACCTTCTCCCACATCGCAACCTTCTCCCACGACATCT
TGAGGTAGAAGACGATGGGCAGCAAAATGCAGTTCACCGTGATGCACGAAGCGCCGACGAAGTCTGCCAGGGACGTGAAGTCGTCCTTCAGCACAATCGA
AATGATGACAAGCAGCACCACGAGGATGAACCGCAGCACGACGTACTTGATGGCGTTCGCACCGCGGTACTCCATCGCTTCTTTCTCGGAATCGTCCTTG
TGCACGTTCTCAGCGTCGGCCACCGACACGTACGACATCTTGGAGTTACGGACCACGGCTGGGTCAGCCGGAGTAGTTGTTTGCAGGTAGCTGGTGGCGT
TCTCCAGGTCCCCCTGCTCCGCCTTGTGCATGCCCAGGAACAGACGCTCCGCGATGTAGAACGCCGGGTTGATGATCACCGCGAAGGCGATCGTGATGTG
CAGCTGCATGAAGAGGTAGGCTAGCACGATGGTTCCCCAGTTGGGCGCAAAGCCCAGGTTGGTGAGGCCGGTGTCCGCGTCCGGGTAGATAGTGAAGAGC
AGGTTGCCCGAAATCTGGCATCCCACGGCCGAGTACGCGGTGCTGGCTAGCACCAGGAACAGGATCGAGATGATGCCGACGGTGACGCCCACGACACGCG
GCATGCGCTTGGGGTCGCTGTGCTGGCGCTGGATGTCCGGGATCACGATACCAGCCCCGTAGGCGAGCGACAGGTTGCCGAAGCAACCAGCGACCTGCTC
GAACGAAAGGTCAGGCGTCGGCACGCTCGGGTGGCCACTGAGTCCGTGCATGACTACAGCCACGGCGAGGATGTCGGCAATGATCGTTCCCAGGCATCCG
GCGAAGGCGGCGCCAGCTCCTTCCTTGAGGGTGGGCACCAAGCAAACAGGCAGCACCGTGAGCGCCATGAGGATGATCCACGTCGTCTGGCTGAAGGCTC
CCGGGAAGAGGCCGTCCAGCAGCGAACCGCCGAGGACCAGGAAGACGCACGGGAGGAGAAGGCACGAGCCCATTTGCGAGACGATACACAGCCAGCGACC
AATCGGCCCCATGCACCACTGACCGAGGTCTCCAAACGTCTTGACGGACTTGGGCGCGAGCAGCATGACCTTGGACATGGTCATGGACGCGTAGATGTTG
GCGAAGGCCATGAAGGCCATGGCGACAACAGCGAGGAAAGGGCCGGCGCGCGAGAAGTTGCCGGGCATACCAAGAGTACCAACGCCGTAGATACAGCAGA
AGAGGTTGAAGGCCGACTTGGCGTCCTCCGCGGTGAAGAAAGGGCCCTTAGCCATGGTTGTCAGGGACGGCAAAGGATTGGAGCGCGCTGTTGATCAGAG
GCTTGAGCTGGAGGCAGCCAAATTGACAATGATGAAGTGGGTGG