Description :
From Genome Similarity Track
Location :
Scaffold_260:28791- 29973
Transcript NameFunction/comments
Phyag_g4051hypothetical protein

Sequence
1182 bases(100 bases per row)
TTACATGTGCTAGATTACCTACGCTCGGCTGTCAGGCCTCGGGTGTCTGCACAGCACGACAACCCGTAAGAAACAAGATCTGTTAAAAACTGAAGCTCAA
GGCAGAGCTTGGTCACATGCCGACCATCCTTGCATTGGATCTTCAAACGTCGTAGCAAACCTGATCGTGGCGATGGTGCAGGCTCAAAGTGCtccacgct
gctgtcgattGAGCGTGGCGTGGACAACAGAAACCGCTTGGGGCTTGACCATCTTCGCTAGCGAACTCGAGCGCGATTTGTTGCATCTCGGCCCAATggc
tcgcgcagcttggacaGCGAGTGTGTCGACGCTCTCGTATCTTCTCCAACATCCGCTCAGCCGTGGTGCGAACCTTCAATTCATAGTCGGCTTTCATCTG
CTTTGCCTCGTTCGACTGCGCATAATTCGTGGTTGCTGCTCACAGGGTCGTAAAGGTACAAGCAGCGAAATGTTAAGCACGTTCGGTACCCGGTGCAACA
GGGGAACCGCTCTTACCAATCCGTTGCCATCTCTTCAACTCCTTCTTCGTACTATCGAAGTCATCCTGagtctgctgcatctgccaCATGGCCTgctcga
gttgctgtcgacgacgcaccAACTCGTTCTGCAGTCGAAATGAATGACTCGAGGTCATCCGCTGAATTTGGAgcgcttcatccagctcaGCCTTCATCTC
TTGTAGGTGCTCCCGGAGATCAGATGCGGTTGTGACCGGCTGTGCACTATGGCTAGAACGTATGGTTCCATCGTTGTCGAACCTCGTTCTAGCGCTGATG
GACAAGTACAGTCGAACTGCGTTTCTGGGAGCAGCTTTGCGTCGGCAAACCGGACAAGCTTCGTGACGTGCAAGTGCTTGAATCAGACAATTGTGGTGGA
AAACGTGACCACACGACAGAGTTGCCAAGTCTACCTTCATCGTCTCGAGGCATATCACGCATGCGTTGATAGCTTCCCCGCTCTCGCACTTCTCTGATGA
AGACCAGTATCCATACGTAGCAGACTCGGCTCGATACAACGCCATTTTTCACAGAATGAGACTTCTGAGGCACTAGTAAGTGATCAATTCTAGTGATACC
GTCAGTACGATGGAGAACACAGCGAGAATAACACGGTCGTAAGACATCTGCGAAGATGTAATTGCGCCACGTCCCGCTTCAA