Description :
From Genome Similarity Track
Location :
Scaffold_47:287819- 288824
Transcript NameFunction/comments
Phyra_80278phox domain-containing protein, partial

Sequence
1005 bases(100 bases per row)
CGCGGCCGGCCCGCCGTGGACGTGATCGCTACGTACATGAACACGTGTGACCAGCGCACGGTGAAATCGGAGCTCATGCGTGCCCACGCGCACTTTGCCT
CACCTCGAGGTACGGACATGCTCTTTTGCTCTTGCCTGCTGTGGTTGAAGTTGAAGGCCATTGCGGCGCAGACGAAAGAACTGACTGTAGTGATTTGGTG
TTTTGTCGTTGACACGTTTGTGTTGCGTTGTTTGTTGCTGCTGTTGGTGAAGGTGGCCCGCCGTCGCGCATCCGTTCGTCTTCCATTATGAGCAAGGAGG
GCAGTGCTGAATGGGGCTGGTTCGCCGACATCGACTCGAGTAGCGAAAGCTGGGGTGGCGATGGTTCCATCCACTCGCTGCGGCGCCGACTAAGCGCTGA
CTTGGGACTCATCGACGTGGGCAACGTCCACGTCCTGGGTGATGAACAGACCAACACACGCATCACAGCAGCGCACAAGACGTTTACAATAGTCACGGAA
GGCAACAGCAAGGTGGTCTCAGCTACAGTGTCCATTCCCAAGTTCCGCATTGTGCAGTCACGCTCCGGCGCCGACCGCCACGCGCAGTATTTAATCACCC
TCATGCTCGGCAAGGAGCTGTACGCAGACTGGCGTCGGTACTCGGAGTTTGGTGAACTAGTGAAGACGCTGGATGAAAAGCGCTACACGCGGACACAAGA
TGCCTGGGCAGGAATCGAGACGCGCTGGTTCAATCGGCTAGAACCGTCGTATTTGCACCAGAAATGCATCACACTCGAGAACTTCATGCGCGAGCTCATG
TACGAGTCGAACGAGCCGAATGTGCTGATCAACTTCCTCGGCGGCTATCTGGGTAAGGTTAACGCGCGGCCTACGGACCCCGTGGCATATCGCCCAGCAG
CTCAGCTCCCGAAGGAGCTTCGTCCACCACAGCCGCAACACGAGCGAGAGCTGTTCGAGAAGATGTGGGCTGAGAACTTTAAACGGTCACATGTGGAGTA
CTCGA