Description :
From Genome Similarity Track
Location :
Scaffold_182:28772- 31318
Transcript NameFunction/comments
Albla_Nc14092890

Sequence
2546 bases(100 bases per row)
AAACCATTCTAACGCATACATTTTGTTCTTTTGGAAGGATAAATAGGCTTCTACAAGCTCTGATGTCGCGTCGTAATTGCGAGATTGTGAACGAAGTAAG
ATGTTCTCGATCTCAGCTCGTTCACATGACGATAGCGTTGCTGTCGCGGGTAATGATAACAATACTTCAGCGTACGGTGCCAACATTGGAAAACGTAATT
GATTCTGTCGCCACCAGTACAGGGGATCCACGTTTCGCTCGGCCACTGGGAGGTTCATGTATGTGGTTAATTCTTTCTCCCAAGTGACAAATAAATCCTT
TTCATCCGAAAGCGTGTCTCGGGCTGAGCTTGCAGACGGTAAATGAGAGAGCAGATCATCGTCATCATCATGGTGGACGCCATGTGCAGCCAGATCAAAT
GTTGACTTGCCCAATGCATCGGACATGGCGACGAAATGTCCCGTCTTCAGCTCAGAGGTAGGATCGTGGTCCGACTTTGCAGAGTGAAATGATGTTTGAG
TCGCTTTCGACCATCCACGCAGCGATCGAAGGTACTTGAGACCGTTTTCTACGTCTGGTTTGACTGTAACATAGCAATACTCGCGGTCTTTATATCGTGG
GTCGAGTATTGTGGCCGCATAATAAATGCGTGGTAGTCTGCAGAAACTAGAACGGAGTCTGCCTTCCAATTTTCGAAAGAAAATGGCCCAATGCACATCG
TCCGATGATCTTCCTTTTCCCTCTTCGATGGCTTGTTTCTCTGCGTATGTGACTAATGCTGCACCAATCGTAGAGATACTTGAAATTCCATGCTTGAAAA
ATTCCTTATCGCTTCCAGTAAACGAGCTTTTATCGCCATGTAGAGCCTCCCAATATCGCTGAAATGGACGCATTTTTTTTAGGTACATTGTAACCCACTC
TGACGGGTACTTTGGGAGATGCTTGAGTGCAAAGGTATCCGTAATCTGCTCCATTCTCCGTGCTTGAGCTTGAAATATGCACAAGTAATCGTAGAACCAA
GGATCTTCAGACCAAACTTCCGATTTACTACTTTGTAAAATGCTTTTGTAGTCGAAACCTTTTGGAGAATGTTGACGGATCTGAGCATCAACTGCATGAT
TATCGGAAAGGGCATGGACGAAAGATTCGATAGCCAATAGCTCCGTACTGAAAGACTCACTCAAGATGGATTTACTTAGACACGGTTCGATGCTTTTGGA
CGAGGAGATGAACATGCTAGCTTTGAGAGACTCATTCCCACCCTGATCATCGATCTGTGACAAAGCGACCGAGAGATGCTGAGAATCGGTCAGAGACAAT
TCCGATTCAAGCGGCTCAAAATGTTGAGATAGAGAGATATTTCCTCGCTGTAAGTGGCCAGACTCGATGTAAACAACGACTTTGTCACGTAATCCAATAC
GCTACAGAGACACAAGGAAAGTGAATATTTTTTGAAAATGAGGAGCATCAAACTCACGTCAACAACTGTGCCGATAACCTCATCTACAAACGCGGAATCG
ACTTTGCGTTGCGTATCCAACCATTTTGTCGGAGCACAGTGAAGAACGACGTGAAACTCACGAAAATTGACTGAAAAATGCACCGAAACAGCAAGGAACG
ATTCCGAATCCAAAAGCACGTCAGTGAGTTGCCATAAATCTACTGATATTCCAACCTGTGAAAGCCAAAATTAGTGAGACACAAGCACTTGAGCATCATT
CGATAAAAGTGTAAAGCACACTTACGGCACGAGTACGGGCAATCAGCATTTTGGTCGTCAATATCAAGCTTTCTTGTAGGATGGTGATACTTTTCTTGAG
GGCATCTTCGGATGGAATAGGAATGCTTTTATCGCCAACAAGCTGCTGGATGAAGTGATGAAATCCCGTCCGATTTGCGAATTCGAGGGGGAAATTCTCA
AGTAATAAGAATAAAGCTATGTTCGCCACAAAAAAGATAGTGTTAGATTTGAGGTACATCTCATAACAACATAATCTACAAAATTCCGAGTACCTATTTC
CTGACTGAGTTGGTCGGGATTGAATGGAAATGATTGATTAACAGTTCCAGGTAAAAGTGCGAATGCTCCGCTCGATTGTGTTGCAGCTGCTAAGGCTTCT
CTTTGTTCCCGCGTCAACGTCGCTGCTGCTGCAGCGACTGTAGCTTGTTGATAAAATGCAGCTGTAGCCATCGCATTGGGCGTATGTCGATATGCATATG
GACTATGACCCGCTCCTAGAGAATTTGCAAGACCAGCACCTGAATTTGCAGCAGCGTTTGAAGACAATCCAGCGAGTGCGGCTGCATCGTTCACATTTCC
AAGCCCATGTCCCATCGCAACTGTCAATTTCTGACGTTTAATGTGCCGCTTACTTTCGCGATGTTCTTCACAAATCAAATTCGCTTGCTGATGTGATGGA
TCTGTTCTTCCAGCGGTTCTCAAATGTGATAATAAATTGGACGAATGGTGTCCCTTAACGACGCGATTGCAGAATTTACAGATGGAATTCCCCATTGTGT
CTTTTTCAAAGTACGCCCATACCGCCGAAACGCTTGGAGGTGCATT