Description :
From Genome Similarity Track
Location :
Scaffold_755:2877- 4597
Sequence
1720 bases(100 bases per row)
CATTCGACACAGGCATGGTTGTTACAATCTTCAGGCCGGAACAGAAGATTGGAAAGATAAGCGCTGCTTTACTATCGAACTGTCCGTTGGGAGATTCGGC
AATATGAGAATGGAGAAGATGAGTTACTCGGCACATTGCTGCGATTATAAGGCCTCGTNNNNNNNNNNGGAAGTCTCTGCGTGAAAAAGTGAAGAGATTG
TTGGAGGTGTGCGATAAGTGGAACTTGTCGATNNNNNNNNNNCAACGATAGATCAAAAACGCTCTATACGGATATTTGCAAATTGGCGCAGGATCCGAAT
CGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNTGGACAAAAGTTTCTGGCGACGTCGCAAGGTGGAATACCTAGAACACCATATCTCGCTCGCAGGTTGAGAAGCTAACCCGAAT
GATTTGGGATCGTTGGTGAACATCTCGTTCCCTTGNNNNNNNNNNGAAAATCGACATAGGATCCGAATCGGTCACGGCCGGATCACCAAAGCTGATCGGT
TTATTCACCGATGGTGAACCAGATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATAAGTGAAAT
TTGTCGATCGGTTTGGCCAACAGTTTTTGGGGACGTCGCAAAGTGGAATACCTAGAACATCAAATCTCGCTCGCAAGTTTGGAAGCTAATCCGAACAAAT
CGGGATCGTTGGTGAACATCCCGTTTACTCGGACGCTGCGATCGGTGCAGTCATTTTTGGAAGTCTTAACTACTACNNNNNNNNNNCCATGAGATCAGCC
GCGTTAATGGACCGCCAAAACCTATGTCTGCTGTGGGACCTGATGACATTCGAGAAGGGTGTGAAGGATATAAATGCGATATACCCCCCAAACGGGAGAT
TGATGTCGATTGGTACCCAGTTGCAGGGGACGANNNNNNNNNNATGCGATAGGGCTTGATGACATTCGCGAAGGGTGTGGAGGAAATAAATGCGATATAC
CCTCAAAACGGGAGATCCATTTCGATCGGTACCCAATTTCAGGGGACGCTCACGATCTGTACCCATATCCGGAGATCGATGTCGATCGGTACNNNNNNNN
NNTCATCCGCGTTAGTGAAGCTCCAGTGTATCAGCCGTGGGACCTAATGATATTCGTTAAGGGTGTGAAGGATACAAACACGATATGCCCCATTAACTGT
TTATCGATGTCGATCGGTACCCAACTTCAGGGAATGATCGCGATCTGTACCCAAAACCNNNNNNNNNNNNNNNNNNNNATTGGTACCCAATTGCAGGGAA
CGATCACGATTTCGAAGTCAGGGATCGTTGGGAGACATCAATGACCTTATTCACGTTGATAAAGTCTAAGGTAGCCACTTCACCGATCTTGAAACAATTT
CATCCGAATCGATCGCCTGT