Description :
From Genome Similarity Track
Location :
Scaffold_7:287589- 291272
Transcript NameFunction/comments
Physo_111761predicted protein
Physo_129258hypothetical protein

Sequence
3683 bases(100 bases per row)
CGACGTTGGTTGGCTGGCAGGGGCTTGCTGGACGCGGCCATTCATTCGGTCCATCGGAGCTCTTGGCACTCTAGCGCCCATTCCGGAAAAGCTCTTCTCC
CAGTTTTCCCAAGAAACTCAGAACTTCGCAATGTCTGGACGTGGATTCGGTCGTGGTGGTGGTCGCGGTGGCCGCGGTGGAGGCCGCGGCGGCGGCCGTG
GCGGTGGCCGTGGCGCTGGCTTCGGTGGCCGCGGCGGACGTGGCGGCGGCCGTGGAGGAGGCCGTGGTGGCGCCGGTGGTCGTGGTGGCCGCGGTGGCGG
CCGTGGCGGTGGCCGTGGCGGCGGCCGCGGTGGCATGGCCGGTGGCGCCAAGGTCGTCGTGGAGCCCCACCGTCACGCCGGCATCTTCATCGCCCGCGGC
AAGGAGGACGCTCTTGTGACGCTCAACTCGACGCCCGGCAAGTCGGTGTACGGCGAGAAGCGCATCTCCGTGGACGTGCCCGCCGCCTCGGGCGAGGGCA
CCGAGAAGGTCGAGTACCGTGTGTGGAACCCGTTCCGCTCCAAGATCGCCGCTGCCATCCTGGGCGGTGTGGACAACATCTGGATCCAGCCCGGTGCCAA
GGTGCTGTACCTCGGCGGTGCCTCCGGTACCACCGTGTCGCACGTGTCCGACATCGTCGGCCCCACCGGCGCCGTGTACGCCGTCGAGTTCTCGCACCGT
GTCGGCCGCGACCTCATCAACATGGCTAAGTCGCGCACCAACGTCGTCCCGATCATCGAGGACGCCCGTCACCCGCTCAAGTACCGTATGCTCGTGCCCA
TGGTCGACGTCGTGTTCGCCGATGTCGCCCAGCCTGATCAGGCCCGTATCGTGGCTCTCAACGCCTCGCACTTCCTGAAGAACGGTGGCCACTTCGTCAT
CTCCATCAAGGCTAGCTGCATTGACTCCACGGCCGCCCCCGAGGCTGTGTTCGCCCGCGAGGTCAAGAAGCTGCAGCAGGAGCAGTTCAAGCCCGCCGAG
CAGCTGACGCTGGAGCCGTACGAGCGCGACCACGCCGTGGTTGTCGGCGCCTACCGTGTGCCCAAGAAGGAGAAGAAGTAGATCCTCTCAGGAACAAGCC
ACATGGTTTACACTCTAACTATGCAAATGTGTTTTTCTACACGCTTGGTGTTTGTAGGTCTCCGCCTGGACATGTGGAGCTCACCTCTTCTCCTTCAAGT
CTGCGTCCAAGATAGTCAAGCTGCGCTCTTCCTTCAACGTTGCGGGTGAGGTGTGTGTATCAACTGAGTTCGTGTTGTATATATCTGCATGTGAGTGGGG
CGATTCCAAACGAGGCCTGTTGCAAGGCAGCCTCCTGCTTTCTTGATGATTAGAAGCATTGCGTCGGGCGGACTGAACAAAACGGGGCTCGCTGTCGTTC
TCACCCGCTGAAAAGTGGTCACTGGGGCGGCGGTTGGTCCTATCCGTGATCGAAAGACGTCATCAAAGCCTCCAAGTGGGGTAGATGAGAGAAAGGAAGG
GCAAATAATGCATACTAGTGGTATGTTTGCATGTGTAGATTCGGTCGTCTGTATTGGTTTTAGTTGTAGTGCGGAGGAAGAGTGCAGCAAGAAGAGGTGG
CAGGCACACTAAGGGCGGAGACCTGGTGTTAGTTGCGTCATATCCGGTCTAACATGTTGTGAATGCAGTCCTATCAGAAATACACGTAGTTTCCCATTCA
TCTTCTCTTCCTCGGCTTCATCTCTATTTTTCGTTGCGTATTTTTAGTTGCATGGTGCTCCTTGCTTTGGATTGGACTGTGAGCTGCATTCACATTGGCA
TTTGATCACCAGCATGCACCGAGTCAGCGACCAGCTTCGTGACCGCCACCCGTACGCGGATGAGCCGTTCCGGGAGGCGTACAACTCCAAGGAGGTGAGG
CAAACGACGTTGATGTGCTCAGAACCAACGGACCTAAATGACGTGGTGCTTTCAGGTAACACGTGCCTTCGGCGCCCGAGCAATCCCCAAGTATGCAGAG
TTGTTGGCGATGGAGGATCTTCCTGACGAAGACCGCTGTCGCGCACTTCAGGACTTGCGCGAACTGCTCAGTAGCCCGAACTCGAAGTACACGGCTGTCA
CGAAGGAGCTCATGTTCACCTGCGCAGACCTGACTCAGTCGATCTCCGCCGAGGTTCGCACTGATGCGGCACTAGTGGTGGCATCCCTGGTGCTGTTTGA
AACGGTACGTTCATTTCTTCATCAAACGTCTTGCTCCAAGATCTACTCGATCACTAAAACTTCGATATCAATGCCGACAGGACGCACCGAATGAACTGAG
CGATGAGGTCGTGCTGACTGCGGCGACTCGCTTGCTTGGTGATGACGAAGAGGAGGTCGTTGCTGCTGGCTGCCGCATTTTCATCAACCTGACGATTTCT
AGCGAAGGTTGCTTATTGCTCGCGAACAAACCCGAGGCTATGGCCACTCTGACCAACATGCTGACGACCCAACCGCTGTCGAAGCTACCCACGCGAATTG
TCGACGTGCTTGTGGAGATTCTGGCCAACATCACGCGTGTTTACGAGGGCGCTCGAGCCTGCGCGCAATTTCCTATTGTCGCGCCAGTGTTGTCCCTGAT
CAAGAAGCCGCGGTTGTGTCATGCCGATACGTTGCTGCACTCCGCCATGGTGATCACGAACGTGGCTGCATACAATCAGGCCAAACGAGAGGCCATTCAG
TATAAGGCCGTGGAATTATGCCTCAAAGCGCTGTCGAAGGTGCTCCTTGGCCAAGTGCGCTGTGAAGCCACCGAAAAGCGCGACGAGCTCACTCGATGTC
TGGTTGCAGCCGTGATGGCGCTATCGACTTTGGAAGACGCTAAGCCGCGCGTGATTGAGTTCGGCATTGAGCCGCTGGCGCAGTGTCTGACGCACAGCAG
CGCCTCTGTGCGGCAGAACGCCAGCATCGCGATCAATTCTGCGTGTGAACTACCACGCGGGATAGCTCCGTTCACTCAGAGGCTGCTCTGCTCACCGGAT
CTGCTGGTGGATGTCCTGGGCATCAAGGCCGTGCCTGCCCTTGACAAGAGCTTGAGCAGCTTCGATGACGAGGACACGCCCGCTGCAGTGAAGGCGCTAG
CTGCGATCCAGAAGAAGGATACGTACGGTACTGCGGACCGCATCATCCAGACCCTGGACATGCTGGACAACCTGGTCAGAGCTCTGCTCGAGAGCGACGT
GCCAGCCGAGACGCAGCAAAGCGTCGCAGAAGTGCTCAGGCGGATGAGCGAAGCCGACGCGAGCAACCGACGCCGCGTGAGCAAGTGTATGGTCAAGCAC
AGCGTCCCTGAGGCTCTGTTCGCGCAGATCGTGGGCTTCACGCCGGCCGAGTTCCTCGAGCAGGTAGGGTAGAAGTTGAAGTTGCTCAGGAACATGGCTA
CATGTCGTGGACACGATTTAACAGGTTATATAATGATGGAGGTCAGAACACTGGCTGAGACTGCCACATACAAATTCCAATATGTCTGCTTTCAAGTGGT
TCTGGAAGTGTCGACCACGCCAAGCATCTGTACGTGCGCTATCGTGGTGAGACGGTTGTGTTCGTTGAGCCGAGAGAAGGTTAGCATCTCCCTCGACAAG
GACGGGATTGCGCGTATGCGTATCCAACCACTGGATGGTTTAAGCTCTGTCCTCCTCCGTGAAGACATCTACCAGTTTTTTTT