Description :
From Genome Similarity Track
Location :
Scaffold_259:28758- 29761
Sequence
1003 bases(100 bases per row)
AGGATATTGCATACGAAGATTGACTACCAACCTGTGAAGACAGCAGGCAGGTTGGATGGATGGATAATGCTACTGCGTCATTGCATAAATTGATATTACG
AAATGGATGACAGTATGGATTACGAAGAAACAAGAAAGAACCACCAAGACTCATCGAAATCAGCAACTAAAAGAACCCGGGGACTTGGCGATAAGGAGCA
ACTCGGCGATGAGAACATCAAATCGAATCAGCAATTCGCCAACCTACGACTCGTCGAAAATGCCTTCAAAGATGTGAATGTCCGCCAGGTTAGCAGGAGG
AGGTGCACTCCCGTCAACAGCTGGAGGGTCTGGGTCGTTCTGATTCACATCTTCTTCGAGATCGAGATCGAACTCACCAACCGGGACACCCTCGGGAGCG
AACATAGGGAATTCGGGATTACGCGGACGGAAGCAGGTGTTATACGGGTGTTTCTCTGGATGAGTCAACCACCACACTCGCCACGATTCCTGGTCATCCA
ATTCATCGAGCACGGCGAGCCAATCGGACCAAGTAGGAAACCACGGTTGGTTGATCAGAGCATACATCGGGACAGTTGGCTCGAAATATAACTCCGGGTC
GAGGGTCGGTGCTGGACCAGTTGCTGAGCAAGTCGCCACGGCTTCATGGAGGGCCGTCTCGAGAGACTTCATCACAAGCCTCAACAAATCCCCACTGCGT
TTACGCTCGGCGCTATACGCGAGCCAAAGCGTTAGGAGCTCGGGGAGCTCAGCGACCGATCGACCAGGGTTCAAATCAGGATGCAAACCCATGATCACAC
TCGAATCCACCAACCAGTGGTTCCGCTCTCAGAGCGCCACAAAGATCTTGGTCCGAGTATCGCTGTCTTGAGCCTCGTCAAATTCGCGCGAATCTCCAAG
AAATCGGGCCCAAGCGTCACACAAGATAGCCACTGGGTCAGTTGACTTCGCTGACCTCTTCTTCATGTGAAGACGATGGCGAGTCTAGTCAATAGCATTC
TCC