Description :
From Genome Similarity Track
Location :
Scaffold_50:287534- 294158
Sequence
6624 bases(100 bases per row)
CCTGCGAAAAGACACGCGAACGTAATATATCGATAATACTGGCTCATACTGAATCCTTCTCAAACCAAAACGGATATTAAAGGCGGTCATGGGTTCCTAA
CAGGTAAGTTCATTGAAGGCGTGCATAACGATACCTTGCGTTGTATCGCTAGCCCATTGAGCGTCTGCATACGTATTCCGTCTGGCCGAAGTTTGTCGGC
TTCTATGTTGAGCTCGCTCAGGTAAGTCTTGGAGCTTTTGCTCGTGTTAGGCTAATGAAGTGAAATTAGGAAACATGGTTATATCAATACTAAAGCAAAA
AATGCATATTATTTTCCAGAAGCTCGGCATCACGCTATCATGGAGTAATTTTCATGTGAATGGCAAATATAATTACGTTCTTTCTAGAAGCTATAGTATT
GATCCTGAATACAATGATATGGAACACCGAAAATCTTTTCCAAGTTTTTTCGATGGGTTTTATTATTAATGGTTGAGCTGAAACGTGTGACAGGATCTAG
CTGATATAACTCGTATTTGATGCGTGAGACCTCTTGTACAATCCAGAGCTTTCGTCGTAGATGTGCCAGCTCTTGTTTTTATACATTTGGAGCACGTTTA
TGTATCTGTAGCGGTATTCAAATAGCTCGTTTTTTATTTCTAAATACAAATCCTTTTCGATTAGATATAAGCGAACCCCATTGCTCGAAGCAAAGAGGAT
ATATCTAACACAAAACAAAATGCTACATGTACGACGAAGTGATTACGGGCTCATTTTTTAGCACTCGATTTCAGTATATCGTCGAGAGTTGATCGACGAT
TTGTATTAATCAGTCTTCAATTGCCTTGTGGCTCTGTTTTTCGTGTCCTTTCCATTTGACCAAGAATTTGTATTTATCATTTGCTGGTAGTTTATGATCT
AATATAGTTTCTGCTTCATATATTTGCCCTGAAGCAAAATCTGTGTCTGATGTATCAAGCTTAGCTCGTCTAGATCGTTAGGCGATTTATAGAGGATGTG
TCTTTATTTAGATTGTATTTAAATTCGGTATCCATACAATCCTACGACTTCATGGACGAGATTACTACACATAGCCGATTCTTTATCGAAATGCTTCGAT
TTGAGCCTATAGACAATCGATTTTTCGTTTACAAATACCGCGTCAACCTCTTGTAAGAGATGTTGAATATGTTCAATTTCGGAATGCATTACCGACCCCC
TCGCTTCGCTTGGGGTCATTCCAATATCCCTTTGGATGGCCGAGCTGTACTTAGCGACTAGGTCGGATATAAACGATTTGGTTAGCTTTCGTTGAGTTCG
CAGTATTCGCTGTTTGATTGTTCGATTGAATCGCTCGAATTTTAGCTATTGTAGCTTGCTCTCCTGGCTCGTTGTTGAAATGCTCAATCTTAGTGTTCTT
AAAGTATGATTGGACTTTTTGATTCATGAATTTACCTCCATTATCGCTTGTGGTGGTTTTGGTTTTATGCTGGCTTACAAAATGCTTGAGAGCTTTCAAC
ACCGTATCTGCCTGCTTATTTCTCTACATATCCCACTCGACTATTAATATTGATTCCCGTCAGCAGCGATCGCGACTCCCAAAACGCTAGATCAATCTGC
TATGAATTGGGATTATTGCTGGCTATGTGAAAATGATCGAGCCGCTTCCTCTGGTATTGAAACTACTTAGTTTCAGAATTGCGCGCGTATCATCCCTTAA
CATCTCTGAGTCGCATTGAGCTATCGATAAGCTTTGCTTAATCATATAGAGCTTTGGTGGCTATGAACCCTGCTTTCAGATTGTTGTCGAGCTTTACTAG
TAGATCATCCATCACGCCAAGCGTGGGGCACAGCCACTTCGCTCAAGCTCCAAGTGATGGTATATCATACGGAAATAAATATCGAGTGGCATCGTTGAAA
TCCCATCTGATAAACCCGTCGCTCGTCGTAGTCGTAGTCGAGAGTCGTCTTCTGCTGAGTGTATGTGATACCCCTCTGCCCCACTTTACACCCTCTGCCC
CACTTTACAGATGCGATACTCTTATTGGTACCCGGAAGCGTGATCTGCCCATTCACCACGGATTCGAAAATTTCAGGGTTGAGGACATTAGCGTTGCGTC
CGCGTGCCTGTTAAACGCCTTTAGCCGATACCAGAAATTATGCGTCTCGTCTGGTGTATAGCAGATGTACATTTTGCTCGATAGAGATCCCATAGCATCG
CTTGACTACTCATCTCTGAATAATCTAGGCGTACGGTGATCAAAAGCAGCTTTTTCTTTACTCCTTTTATTGGGAAACCATTCACACTTGTGTTGCTTAA
AGTGCACAAGGAGCTCAGGAAGCAGTTTTGGTGATGTGAAAGCAATATACGCTGAGTCTGTATCCATTTCATGATACAGATAACCACTACGATCGAAGTA
GAGGTCAATGCAATCGTCGTAGAATTGAGGCATACGCTACTTGGCGAGCGGATAGACAGGGACGGACAAGTGAAGCGGATTGCTGAACCTGATGCGCCGA
TTTTTGAAACTTACCCTATTTGATCCAGCCGGCTCCTTCAATATCGTGGCAATTGTGCTTCTCGACAATTGCTCTAACATGGATTGCATCCGAGATGTTT
TTACCTATTTGTGCTTGCTGTTATTCATACCAGATCGTCCAAAAGCACAATTCTCTACGAGTTTCGTCATCTCAGCGTTCATCACCTTATTATCACCGCC
TTTGATGAGGGATTTGAGCTGAACCATTAGCTTACCAATTGGGCTGAGCTTAGGCTTAGAGCCAATTGAGTTAGCGATGCTGTCAAGGGCTTCCGGGTCT
GAAAGCAGCTTCTTCATTACCGTATTTAGCTCTACCTCGCTGGGATGAGAGCTTTCCATCTTCTCGATAATGATTGCGCTGATTGTTCCTATCTTGGCAT
CCCCTCGCGTCGAGCTTTAAGGACAGCTTTTATTAATGATCTAAATACCATGTGTGGCTGGCGTTGATGAATGAGTAAGTCTTTGTGATCTACATTCCGT
GAGCCAGATACCACTTCAGCAATGGAGCATAGATGAGGTTCTTCTCGTCGAAATAGCTACCATTCAACTTGCGAACTGGTTTCACGCGACTAGATTCGCG
ATCCTAGTTGTAGTCTACATATACGAGCCAATGGTCTTCTCGCTAGTACAATCTATCAACACATTTTTAAAAATCGGTGTCATCTCTGAAAAGTATGCTC
AGGCGTTCTGATACCGCATTCGACAAAGCCGAATATCTTGTCATGGTTTGATATCATCGATGATGTCATCATAAGCCTCGATGGCTGTTAGACGACCGCA
AGGCATTTCGTTCCCGAGCGCCCAGAGATAGAGAGCATTGGTGTCGTATTCGATAATCTTCTTGCATGTTTTGCCTCTTAAATGTTGTCTCGTTGCACTT
GGTGAATCGATTGAAAATAATGGATAGACCGCCGACAATGTTCGTCTTCATCTTCGCATAGATGCCCTTCTGTATCGACAGAATGAACCAGTTTCTCACT
GTTGACCTTGAGGGGTTCTGGTATTGAAACGTATAAGGATTCATGCTTTTCCGAGCACAGTTGCATCTGTGACATGACATCATGATATTACCATTGATGT
GCCCGATGGTATTATCGATTCGATCAACACTAAAGATCTTCCCGTCAAGCTGAAGGAAGCAATGGATACATTCGTATTTTGGATCATGAAGAATTTTGTT
GAGTTGATCTGTCGTCAAGTCAAAACTCTCGCTTAGCCTTCTTGTTTCCTCGGTTCCCCGGTACGTCGGCGATCGTGGCTTTCACTTTCTCTGCCATCTC
CAGGGCCGCTCTCACCTTCTGCTCCCACAGGTACTGTTCTTGTCTCTCTTGCTCCATCGCTGTCCGGTCCGGTGAAATTGCTCAACAAGTCCCAGCAAAT
TCGGTCGGTACGGTACCGGTGTTGACCGCTTAGTTTGCATCAGTTCTAACAATTCCGCTGTGACCTTGCTGCAAAATTCCTTAGCTCCGTCCATCGTTAT
CTCGCGCATGGGCCCAAACACCAGGACAACCTTCTCCATCAGAATGCGAACAATCGCCTTCGACGTATGGTCTTTCACTGCCACCGCCACCGCGTATCGA
GTTGTGTATATCACGAACGTAATGACAAATCGATTGCCTTCCGCTGTCTCCGGCAACGGACCTGCAACATCAATGGCCCAACGATCACCTACTGCTCCGG
TTCTCACGCTCCACAGTGGTGGTACCATCTCGCTTTTTTCGACCCTCAGTCTTGACACGCGGAAACCCAGCTCCGAACAGCTTCGCGCATCTGTGGCATT
CGTTGTAGCCTCTCCATCATCTGCGGCACTCTCAGGTGCACATCCCAAATGCTGTCGTGGGCTTCCTTGAACGCTAGTGCCCAGTAGATCGTGGGTAGGA
TGATCCGCCTGACGTCAGGCGTCAGCTTCACCCGGCAAGCCCATCGTCATTAACCAACACACGCTGTCTGCGGCAAGTCCCTTTTACCTTCAGGGTGTTC
ACCATCACTGACTTGCTCTTCTCCCATTTGATGTCCTCGTCCATGAATTGAACTGTTCCCAGCTCAGTCGCTTCTATTGTACCCGCCATAATACTTCGGA
CCAAGATTTGACGGCAATTTACTCGTAGAAGATTATAACTTTCCATATACGATACTTAGATATATAGGTAAATCGCACCCGTAGATTCCGAATTTGAAGT
CAGATTTGACGAATTCGTACTCCTTCTACCTCATTTTTCTCTTACAAAACGTCGTCTTCAAAGTGCCAAAGTTTGGGGAAAGGGTTCAATTAGGTTTAGC
CGATGATTCATCTATTTGCGACCTGTTCATTGGCTCAGACAACAAGCCACATGTCAAACATATGGGTGGTTAGGCTAATGTATCATTTGTGTGGTACAAA
CGTGCACGTCGGAATGAAACTTTACAAGTGTATCCAAAATCGTCTCAACAAAATTATACAGGTCTGAGCTACGTCTCTTCCTCGTCATTGTCATCCAAAC
TTGAGATCTCCTCGACGTTGTCCTCCTCCAGGCCCGCGATCTCCTCTGTGTCGACTGCATCTAAGTACTTATCTTCAACTTTCTGCACGTGTCTGTACTT
GTTCGTCCAGCTTCTCTTCGGGAGGGCTAGCTTCGCATGTTCCAGCTTGGCCTCAAGCTCGGCAATATTGCGGGCTGGGGCGCTAGCAATACTGTTCTTT
AGTTGCCCCCATATCAGTTCAATGGGTTGAAGCTCCGGGTGATATGGGGGCGTGTAAATAATGGTGTGGCCGTACATGATTCCTATCACAGCTGCCATAT
ACAGCGGCAAGGGCTTGTGCGCGCGCACCAGTTCGATAAGTTGGGCCTTCACGGCCGTTGGATCGTATAAAATACCTGTATACAACGCTGGTAAGTATAA
TGCTGAAGAATTAAATATGTAGTCGTACCTTGATCCTGAAGCCATCGTTGAATATCGGCTTTCTTAGATCTTGTTGTTGGCGCAGGTAATATGTTGCGCT
TGTGGTAGGAAGCGCCATCCAAATAGATCTGGCAGCGACCGTACTTTTGACTCAGTGTCTCGCACAGCTTTTGAAACCAACGCTCGAACATCTCTGCGTT
GAAATTACCGTGATAGTCACTTTCATTGCTTTTGCGGCTAGCAACCCAACTTGTAAAGGAATCTTCAACAAAATTTCCTCTCAAACTATTTCCTTGGCGA
TAAATTACGCCTGCAGCAACAATACAAATTCTAAAACATATTTAAATTAACTTACAACTTTAGATCAAGCGCATGCATATTTTATAAAACAATAAATCCA
TACCTTGCACCTTGTCGCTGGCTGAGAATCTCTTCGCATCGGGAGGTAGCCACGTCGTTCCTCGGACATGGTTCACGTTGACGTATGATTCATCTAAGTA
GACTTCCGGGAGAATGGGATTGTTGCTTTTGTTCCTATTCAGTAGTTTGCGCTGCAGATAGGTTGCTCGGTACGCCACATTAGCGGCTGATTCGGCGAGA
TAGTGGCGCTTCTCGCCTTTGATGTACTTGTAGCCAAGTCGCCTAAGCAACCGGCACATTGAACGATATCCAATACGAATAGACGTCCGAGTCTCTACCT
CTTCTGCGACCAGCTTCGCAGTGATAGGTCGTTGCATTCGTTCACGTACGCTCTGATGGCGAGCTCAACATCCCCGTCGTTGAAGCTTCTTGGCCGCCCA
CGTGATTCCGTGGCATATTAAATTAAAGAGGTCAGTGATATATAACTGAAATAGTGCTGGAGGAGCTCACCTCGGCCGATGAAGCGCCCTCCTGCTCCAT
GTGTGAGGCCCACACGGCTGAAACGGTGCTTGCTGCAACGCCCAAACACTGGGCAACAAGACTGCGCGTTCGTTTGCCGCGCGAATAACCCTCGTTTTTC
TCTGCGAGGAAGAACTTGTAGGCATGGATAACCATACCAATCTGCTCGTCGCTAAGTTTCCGTCCCTGAGCCATCCTGGAAGTGAAAGGTGACGACTGAG
TTGATTTGTTAATGAACGAGTGGACGATAAGGATTCGTTTGTGGGGCTGGGTAGCTTTGTCTGCCACGAACTGACCGAGTTACAGCCAAAACTATAGTGG
TGTTACAATTCTTGGTCCGAAGTA