Description :
From Genome Similarity Track
Location :
Scaffold_17:287524- 292936
Sequence
5412 bases(100 bases per row)
ACTTCCTCTAGCGCAAGGTGCTGTGTGACCCCGTCACACTTGGTAGCACTCGTAGTCAATCCACGCCACCGCGGGTAGACTACCTGAACCCCTCCGAAGT
TCGTTGCCACGGATAGGAACGACTTCTCCCATATGAACGACTCTCAGTTCGAGTCGGTTCGGAAGATCTTCGGGATGGAGGCCCTGCAAGGCCTGGTGGT
GTCAACACCGGCTGAGCAGCTCGAGCGCGTCAATGCATTCGACGCGTACGAGCAGGGCCTCATCGCGCATGTGCGGGAGAACCTGCAGGCTCCAGCGGCG
GAAGCAAATCCGCCTCACCCGAAGCCAATACGGCTGAAGGTTAAGCCGTATGAAGGGAAGGAAGGCGAGAACCTTCGCTTCTGGGTCCGAGAAGTAGAGC
TCGCGATGGACGCGGCTCTGATCTCGACCGAGCAACTGCGTGTTGCTTTTGCACTCTCCAACCTTAGCGGCCGTGCTAAGAGTTGGGTGTACACACGGGA
AGCAACATCCCCTGGATGTTTCACATCCTGGGCTCAGCTGTGCGAACAGCTCCGAGCCGCTTTCCTCCCGGCGAACTACGAGTACCGCCAGCGTTCGCGC
TTCCTCTTGTGTAAACAAGGAAGGCGCGAACTGCACGAGTATGTGCAAGGGATACGGGAGCACACGGCGTCCCTAGTGGGACACCCACTCAGCGAACACA
TCAAGATAACTGTGTTCATGGACGGCCTTCGAGTGGGCCCCGCACGCACTCAGCTGTTCCGGGTGCAGTCAAGCACTCTTGAAGAGGCGATTCAAGTGGC
TCTTCAAGAAGAGTACAGCCATCGCCAGGCGCGTACGCCGGCCTCAGCATGGCCTGGAAGTTCTTTGTCGGCTCCCGGCCGATCAAGCCCCAACGGACCA
GTTCCCATGGAACTCGGGTCCGCCGAACAGCGTGACATCCACTGCTTCGGCTGCGGGAACATGGGCCGCTTCAAGCGCGACTGTCCTGCGGAAAGACTCC
GCAGACGGTCCTTCCCCGAGCCCGTCCTCAAGGGTCGCTGGCAGAAGCCAGGATCCCGGGGACAGGGGAACGCTGGGAACCAGTAGGGGCGGGGCGCCCT
ACTGGGGAAGAACTAAGTCTTCGTGATGGGTGCGCGGGTGGCGCGTACCACGGGGACCTAGCCCCTGAGAGTCTTCGCACTCTCGAATCGGCGAGCAGCG
GCGGGTTGCTCGTAGTACACGGATGTGTACGGGGATACGATCATTCCTTTAGAATCTTGATCGATTCTGGGGCGTCGAAGAATTTCGCACGCCGCCAGAC
GGTTGCTCGCAGCAGCAACAAGTTGTCCGATGCTTTGAGAGAACGCAAGGGCAACGGGACGGTGTCAGTGCGACTGGCCGACGGGAAGGTCGTCACTGTC
CCCAACGTCCAAGTGGATCTGGCCGTCAAGTTTGAAGACTTTGACAGCCTCAAACAGTTCACTGTTCTCGATATGGATCCATTTGATATGATCCTGGGCA
TGCCCTGGCTTGAGAAGCACGAGCCCTGGATCGACTGGCGAGGCAAGGCAATCGGTGCCAGCCGCCCTGCGCAGTCCGACAGAGCATTGGTGAGTCATGT
TCCCACCTCTGTCAGGACCCGGGGCGCCCGCAAGGGCTGCCAGGGTACCCAAGCATTCGGCAGATGCTTGGGAGTCGTCGACGTATATGACGACTCCGAG
AATGTTTTGATGGTGGCAGCGCCCAGAAGAGGCGCTGGCCAAGTGGGTAACTTAGGTCCACAGGCGGGTAACTTAGTTCCGCAGGCAGCTGCAGCTGTCA
CGAACACTGAGAACAGCGTGTTCAGAGTGGATAACAGAGCTCCACTCACGGTCGCCCAGACCTTAACTGAAGACGGAGACGTCGGATACGCTTCCTGTGT
GGGTAACACAGTGCCACACGCAGTCGTTCGGACCTTAACTGAAGAGGAAGGCGTCGAACACGCTTCCTGTGTGGGTACCACAGTACCACACGCGGTCGCC
CAGACCTTAACTGAAGAGGAAGGCGTCGAACACGCTTCCTGTGTGGGTATTACAGTACCACACGAGGCCACGAGTGCCTCGGATGTCGTAGCGCCGACAT
CCCTAAACGTGGGCAGCAAAGCCCGACGTCACGGTCGCCGTCGTCAACGACGCCGCCGCTGCCTCAAGTCGGATCCGAACTTCGTTCCGATCGACGTCGC
TTCAAGCGCCTCGGAGTCCAGGGCCCGGGCTCCTCCGACAAGGCCGGTGGAAGAGTGGTATCACATCTTCGATGGCGAGACCGGTTTACCCGTCAAGGCA
TCTGGTGTCCACTTGGAACCGTTGCCAGAGGTTGCAGAGATACTGCACCTCGAGGAAATGACGGCTGAGTCTTTCCTGACCAACCTCAAGGCTGGAGAGA
TTGCTGAGATGGTACTCATGAGACCTTAGACCACTCGGGAGGAGCTGAACTCCTCCTCTGTTTTGGACGAGAACGTCCTGGAAGACCTGAACAAGCAGCG
TCAGGCGCGCTTGGGTTCTAAAATCCTTAAGAACCCCAAGGATCCGGTGTATCCTTTGGTGAAGAGTATGCGGACGTGTTGAGCAAACACCCACCGACCC
AACTCCCACCGAATCGAGGCGTACGGCACAAAGTATTGTGTCACGAGGCAATGGCCTCTCCCGCGCGAACAGTGCGAGGTCATTGATGCCTTCTTCGCCG
CGAAAGCGAAGGCAGGCATGGTGCGGGAGTCGAAATCCCCGCACTCGACGCCGACTTTCTGCGTTCATAAGCCGAACGGAAAGTGGCGTCTGGTTCACGC
TTATAACAAGCTGAACAACGCAACGGTGCCGGCCCAAACACCACTCCCACGAAAGGATGTGTTGTTGAACAACATGGCCGGGTGCGTACTGTACAGTGCG
CTGGATTTGGTAGACGGATACTACCAAATCCTGATGCGAGAGAGCGACATCCTGCTCACTCCAAGCGGCATGCTTTAAGAGTGGCTCGTCATGCCACAGG
GCTTGTCTAACGCCCCGGCGACGTTCAATCGCCTGGTGACGCAATTGTTCCGCCCTTTGCGTACCTTCGTACAGACGTCCTTCGACGACATATTCGTCCA
TAGCCGTGCCGAAGGAGGCAAGACGGCCATGGAGGTGCACCTAGGACACCTCCGTCGAGTGTTGGACGTAATGCGAGCGAACAAGCTCTACACCAATATC
GACAAGTGTCACCAGAGATTAAAGTTCTCGGTTGCTTCGTAAGCAACGTGGGCGCTCGGGCTGACCCAGACAAGGTTAGGGCCATAGCAGCATGGCCGAC
GCCCCGATCCCAGAAGGAACTTCGAAAGTGGTTGAGCTTGGCCAACTACCTTCACAAGGACAGCGCAGGGTACGCGGGCTTCGCTAAGCCCTTGTCGAGC
CTCCTTCAGAAGGACGTCGACTGGCGCTGGGAGCAGGAGCACCAGGATGCTTTTGACAGCGTCAAGGCCAGTCTCCAAGAGGCCCCTGTCCTGGCCCTGC
CGGACAAGACGAAGCCGTTTAGCGTCGTCTGCGATGCTTCTGATTGCGCCATCGGATGTGCATTGCTGCAGGCCAACACGGCTGGACACGAGCGAGTCAT
CTCGTTCCAGCCCAGGCAGCTCAAAGCCGCCGAGCGGAACTACCCTGTCCACGACAAGGAGCTCCTGGCAATGAAATATGCCCTTGTGAAGTTTTGTGCT
TACCTTCTGGGCTCTAAGCCCTTTGTGATCTACACAGACCACGCGTCCTTGAGGACGGCGACTAACTCGCCTAACCTCTCCAAAAGGATGGCGAGGTGGC
TGTCCTTCTTCGCGGAGTACAACTTCTGCGTCGAATACAAGCCGGGCAAGCTCAACGTGCTTGCGGACGCCCTCTCTCGGCTTCCTGACTATGAGTTGGC
CCACATCACGCGGGTGACAACGGATCTATATGATCGGATACGCATGGCGTATCGGGACGATGAGGCTGTCGCGCCTATCGTCAAGTTCCTTATGACCGGA
ACGAGCGCGAAGTCCGACTGGCTCTCGTCGCGACAGCGCTCACGGCTTCACCGATATGAGTTTAAAGAGGGTATTCTCTATTACCGGGTGGAGCCCACTG
ATCCTCCACGGGTGGTCGTACCCAACGACGAGGATCTGAAGTTCGATATCCTCGCGGAGGCGCATGACGCGCCCTCCAGCGGCCACTTGGGCCGCGAGAA
GACCTTTCTGTCGGTCTCTCAGTCCTTCTAGTGGATCCACATGTACAAGTGGGTCGCCCGGTACGTTAAGACATGCGAAACATGTCAGCGGGTCAAACCC
GCAGGGCACTCTTCGGCTCCACTACAGAGCCTGCCCGTACCGGCTGACTGTTGGAAGTCGATGAGTCTTGACTTCATCTTTGGGCTTCCCACCGACGGAC
ACGGCAACACCGGAATTTTGGTGTTCGTGTGTCGGCTGAGCAAGATGGTACATCTTGCTCCAGTTCCCGTCACTGTTACGGGCGAACAAACCGCAAGGTT
GTTCGTCGATGGCGTGTTCCGCTATCACGGTCTCCCGGAGACGATTGTCTTGGACCGAGACCCGCGGTTCACCGCTGCGTTTTGGAAAACGCTGATCCCT
TTACTGGGACCACGTCTGCAGATGTCCACTGCGGATCATCCGCAGACAGACGGCCAAACAGAGCGCGTCAATCGAGTACTCGAGGACACTCTGCGCAGTG
TGTGCACGGCAGCACCACGTACGTGGTCGACGCAGCTTCCAGTTGTTGAGTTTGCGCTCAACAACGCGGTGCACGCGTCCACGGGGTTCACGCCGTTCTA
CTTGAACGGCTTTCGCCACCCCAGAGTGCCTCTCACTCTTCGAGGAGACACTGACTCCTCTATTCTAAGTGGGGTCGAGGCTCGGAAAGCCCTTTCCTCC
CAGGTCTCGGATGTGAGACCAGTTTCGCTGCGGAAACATGTGGAATCCTTTATGAATACCAAGCTGAGCATTGTCAGCAGGGTCCGCGATGCCATGGCAG
CGGCCCAAGATAAACAAAAGGAGTACTCAGACAAACATGGAAGAGGAAACTTAAGTATATTTGAGGTTGGGGACTTAGTGTTGCTAGACACGAGGAACCT
ACCTCTTGACACTGTCAGCTCTGTCGGCAGCAACAAGCTGAAGCACCGCTTCATCGGACCTTTTGCAGTCCTGGCCAGACATGGTGCGTCGTACACCATC
GACCTTCCAAAGTCAATGACGACGCACCCGACGTTCTATGTTGGACGTCTTAAGCGGTACTTTGACCCGCAGGGGGTTGCTGATTCGCAGACCCCCTTGA
CCCAGCTCCTCGAAGCGAGGGCCGGTCACAGTCGTCGACGAGGACGTCGGAGCAGGCACTAAAGCCTCGGTCGAGACGGCAAGGCTGCGGTCAAGGCCGT
ACGCCGGAGGGG