Description :
From Genome Similarity Track
Location :
Scaffold_16:287512- 302923
Transcript NameFunction/comments
Phyra_76134lectin, putative
Phyra_76135Cyclin-G1
Phyra_76136lectin putative
Phyra_76137Hypothetical protein
Phyra_76138Hypothetical protein
Phyra_76139ferric reductase, putative
Phyra_94384glutamine cyclotransferase
Phyra_76141ferric reductase, putative

Sequence
15411 bases(100 bases per row)
GGAGACACAGCCGTAAACCGCCACTTCGCGCGCCTCACGCCCGACCGCCAGAGCAAGCGCGGCCACATCTGGGGCTCGCAGAAGCTGGCGACCAAGGAGT
TTGCCGCCGTATTGACGTTCCGAATCAGCGGCCAGGCTAAGGCCTGGTTTGGCGACGGCCTGGCGCTATGGCTCACCACCAGCAAGTACGTGCAGGGAGG
CAACCACGGCTTTATCGGGGACTTCAAAGGTATCGGCGTCGTGTTCGACACGTTCGTGAACCAGGAGCACAGCGGCGGGCACAAGGACGTGACGTTCTTC
GAGAACGACGGCTCCAAGACACTGGACGACCTCAACGACATGGACAAGGTCGGTTGTATGGCGCCGGGCATCCGCTACCACGAGAAGAACGCGGCCTTTA
GTCCTTCGCTCAACATGTCCCGTGCCAAGATCACGTACACGCAAGCGGACCAGCAGATTACGATCCTCATCGATGCGGACGCGTCGGGAAACTGGGTCAA
GTGCTACAGCCAGCGGCTGAACATTGGCGACGACTGGATGAACGACGCGTACGTCGGAATTTCGGCCTCTACCGGTGGGCTGGCCGACAACCACGACGTC
ATTGCGTTCAACATCTACGAGTACGTTGGGTTGGTGTGCTCGGTGAGTTTGGTTATTGTTGATGGTGGGGCTAACTATTCGTTGATGTTTGTGTGTTGTT
TTAGTGATGTGATCGACTCGCTCGCGGACAAGGAGGACGAGAAGCAGCGTAATGCCGTGGATAAGGACTTGGAAGCTACTCTGAGCAAGGGCAGCAACGA
CGACAAGATGAAGCTGGTGAAGCGGAAGTACGCTCAGTTGCTCGAAGACTTTGAGTACCAGTTTACTGCGCTGAAGGAGTCCACGGAGAACACGATCCAG
AAGTTGAAGGAGCAGGGTGCTGAGGACGAGAAGCGTATCGATGAGCTTGAGGCCTGGGCGAACGGAAAAGTGGTTGAGCGTGTGCACAGCACCGTGAATG
CCATCCGCGACCAGGTAGAAACGCAGCTAGAGGAGACCGTGAAGGAGACGGCGGCCAAGTCCAGTAGCTGGAAGACTCCGTTCTTCATCATTGTGTTCAT
CATCGCCGGCATTGTTGCTGCCGGTTACAAGAAGTACCAGGACCTTCGCAAGACGCACTTCCTGTAAGGAAATGACGTCTTTCTCAAGATTTATCTTTGC
TCACGTGCACCGGTGCTAGACGCCGTCTGTCAGTCACAATAGAGACGGCAACGTGCAAACTCAGCCAGGAGATAGAATCGCCTGGGGCCAAATGGTATTT
CGCATTCATGTTTTCTGGACTTTAACATTTCTGTGGAGTTTCCACAAAACATGTCTGAGCAACACAACACGCTGGGAGGGAACGGTATGGTACATCTATT
ATATCCTGAATGCGATTAGATCTCAACAAATTTGTACTGGAGTGGTGCCGCGGCAAAGCTTAAATCAAGAAGCCAATTCTTCCTGCACGTGCTCACAAAC
GCGGCAGACACAAGATGGGTCATAGGGTACCTTCCACGGTGAGGGTAGGAAGGCGCCATAGCGACAGCGCAACGCGAACCATGGCTTGAACACTGAATGA
CTCGGGTTGATGTTGTCGCGGTGCGCAAGGTAAAGCATCACCACAGGCTCCAGCATGGGCGGCTTCACTTCAGCAATCTGATTACCGGACACCACAAACC
AAATGGCATCTACAAGTAGATCCTTTGAGAACTGATTGGCTCGCGCCTTGAGAAGCAGCAAGTCTGCAAAGTACAACGCCAATTGACGCTGTTCGAAAGG
GAGGGCGTCAGCTCTGTTATCGTCTTCATCTTGAAGACGGTAAAGCTTCTTCTGCAGCTCGTCAAGAATAGTAGGAGCCATGATTCTGAAGTCGAGGAGC
TGCAAAATCTTAAGCTCATACTCGAGGATTTCGTTCCATGTCCACTGTAAGCAGCAATGAAACAAACATTAGTTATCTCGTCTATATCGCGCACAAGAGA
CACACTTCCACGTACATTGCTGGAGAGTCTCCGACGCTGTAGAATTTCTTTGATGCCCTCATCATAAATGGTCGTCGGTGTCTCTACAAACTTGACGGCA
ATCCACAAGCACCTGCAATTGCAGCAACCAGCAAGTCCCACATATTCCGGTTAGTACTCGTTTGTCCCAACTGCAAACTTCAGCCACAAAAGCTCTTCAG
CTTACGAGATGCTCAACGCTTCGAGTCTAGCTGCTTCAATGCTTTGCAGCGCCAAGAATCTATCTAGCAACCCCACGCACACATGCAGCGTCTCTCGAGA
GAGCCCTAGCGCTGACGTGATGGTCAGAATAGCCGCCACCATCTCGTCTCGATGCGCAGCCGTCGCGAGCTCCTCACTGTCCTGTGCTTGATTCTGGTCC
TCTGCAAATCCGACGCGGTCTACGGACGTCGGGGACTCCGTCTTGGTGCGCTTCAGCTGGTCGTCATCGGCGTGGAGCTGCTGGTTCGTCGGGGGCGGAC
TGCGCACCGGCACCTGCTCCGAGCGAGGTCGCTTGCGGTTGGTGCACATTCCACAGTAAACGGGCGCTCTCTTGAGTCTGAAACTCTATCAAATTCCAGG
GAGCATGCAAGAGCAGAGTGACAGTGAAAGGTCAACGGGCGGGACCGCTGCTCGATGCCCGTGCAAGAAGAGAACTGCGTCTACATCCTGGAGCTCATTG
ACGATTTTTGGCGCCGATAGATACAGCCGTTACGATTTTCCCCGCGGTTTCATGTTCGATTTTCGAGCTCAAACTCGGCAGATTTATCGACGAATCAGAG
TTAAGATAGCTAAGGTTCCGCCAATCAGAGAACGTTTTGGAGTTGATGTGCGTCACTTCATTCCTACACGTCGCATGAATTTGGTTGGCAGGACAACCAG
TCCAATTGAGCATCATGGGCGCCATGAAGCCGTCCAAGAAGCAGCGTGGCAAGCTAAAAGCCTCCAAGACCAAGAAAGAGACGGTACAGGCGCACGTCAA
GTTCGACGACAACGGGGACAAACTCGTGCCCAAGAAGCGCGCGAGAGTTTTCAAGAAGAAGGATGCCGAGGAGGTGAAGGAGGGCGGCGGCAAGTCGGAC
CGCTCTCCGGAGATGATCCAGCAAGCCAAGTACTACCTGGAGCAGTGGCAGAAGCGGGACGAGCCCAAGGCTGATGACGAGCTGCCCTGGAAGTTCAAGG
TTCGTTGAACGACTCACTGTCCGTTGTCGGAGAAAGCAGCAGAGTATGAGGATTGCTGTCGCTAACTACTTTTATTTGTGGCATTGCAGAAAATCAAACA
GCAGTGGATCCTTAAGTGGATGTACGAGGCTGACGTTGTCCCCAAGGCCATGTTTAGCGTTGTGCTGGAGTACCTCAACGGTATTCAAGGTGCTGCACGG
AAGGTCAGTAGTGAAGAACGTGGTAGAACTGTTGGATTTTGCTGACCGGTGGTTGATTTTTTTCTGTCGCAGCGTGTGATGGAGTCGGCGCAAGGAGTCA
TTGACATTGGTGTTCCAGCGAAAGAAGAGGAAGAAGCTGCGGCGGAGGAGAAGGAGAAGATGCTCAGTATTAAGCTCGCTCGGCGGCGTTACAAGAGAGC
GCTGCAAGTCGCGGAGCTGCTGGCGTAAAACTTTTTCTAGAAACAAAAAGTCTATTCTTGCTTACCTTTTTCCCATGTTGCTGCTTTGGTTTTGGCCGCA
GTTTGTTGCTGCGAATGCCTAACATTAATCAACGTGGTCTCCGATGTGATCCACAACAATGTCACGGAATCGATCAGGAGAGCAAAGGCCGTTTGGAGAC
TCTCCTATCGCTAGAAATTCGCCGTTCAGTCGAGTACGAACAAAGAATTTTCCGTTCTCGTCTTCTAGCAGCTCGAGTGCAAGAGCTGAGGAGTACTCAG
GCCACCAGTCGATGTTGTTGGTGATCTCGGCGTCCATCGTTCGCAGAACGGCTAAGAGCGATACATCATGTCCGCTGTAGATCACGAGCTTTTTGCTTTC
GCTGTGTTCCCAGAGCACCTTTTGCATCTGCAAGTCAGAAAACGAGTCCACCACTTTGTCAAGAGCAGTGTTGCATGCGTCCCCGTGAACAGACGTTTGG
ATTACCTCACGAAGCATGTTGTGCATCAAGCGTCCGGCTACGAGTTTCAGGATCGTCCGATGCGAGTAGAACTGCAGACATCATAGACATTCCGTCAGTA
TTCACTACCCAAGGCTGATCCCTGGTCGTCCTTACCTGGTGGAAACGAAAGCCGAGGTGTCTTTCGGTGGCTTCACCGTGAACCTCTGTGCCAAGGATGT
ACGGGGCCTGGTGAACACGACGGCAAACGTAGTAGTCGGCCGGAGTCAACCACGAAAAAGGAACTAGACCCGAGTTAAAAGCCGGAAACAGCTTCATCAA
CTCTTGCTTGACCGGGGCCATTTCGTGCTCGCGCGCCGCAAATTCAGCGTTGTCTTTTTCCATGGCCGCCTTCATTTCCATAATCTCAGGGAAAACTCCG
TACGCTGATCGTACCAATCCCCGCAATAATACCATAATCAATATTCCAGTCAGTTTGTTTCCAAGGACAAGCACGAACCATTGTGGCTCAATGAGCAATT
TCAGCACGCACTGTTGATGATGTCTTTTTCCGGTGGGAGCACACTGACTGGAGGAGTCAACTGTGGCTGGTCACGCAGCAGCCCGTCCAATAGTGCCTGG
GCACTAAGTTGGGTGCGCGTGTACGCATTACTAAAGATTTGTATTTGTTCAGGCGTCACCTCATCCAGCCGCAATTCCTCTTTCTTGCAAAACTCTCGCT
GCCACAGTCATCTGTAAGTTCCCCGGTGCATATCCTAGTCATTCAACTGCGTCTCACCAGTCGGTCCCCACGCATCGTCATCTGCTCGATGCCTCGCGTC
GTCAAGTACCCGAACGGCCGCTGCTGGAACGAGCTCTGCGCGTCTCCACCCAAGTGGACGCTGAACTTGGAACGGATATGCGCGAGTTGCGTGGCCTCGG
GTAGCTGCCGCCCCCATAGCAGCGCCTCCTCCTCCTCTGAGCGAGAATTGATGCTCCCTTTGAAGATGTTGAGCAATGGGGTGCGATCACCGTGGCGGTG
AACCACCTGCAACTGGCGAAGACGCAGTCCCATCGGAGCGTAGACTGTGTGGGCTTTGCAGCACGACACTTTTGTCGATGCATCACTGTTTTATTTGTGT
GCACCACTCCATATCGTCGTTTAAAAACCGACCGCGAATGTTCAATCTACTTTGCAAGGATATTGATATGTGAAATCTTTTACGGTAATATACTTGACAT
TTGTAGAACTCAATGAAACAGACTATCTATTGATAGAGGTCGTTGAGAATTCAAAACGCTAAGCCAGGATTAGCCTGTGTAAACCGCGCACTTTGCATGT
CTGGAGGGCACTACGTGCTTACCCACCTCGCCCGGTCAAGATGGCGAAGGAAGCCATGGCCGCGGCCTCCACGCTGTCCTTGAAGGATGCACAGCGATGC
TTTGACAAGGTACACCAAACTGAAGGCGTTCATGTTTAGGCTGTTTGAGTCAAATGTAGCCATCTATGCTCACAAGGGCTTGTCTGTTGTAAAATACCAG
GAGCGTCGTTCGTTCCTGCGCGATCTCGAAACGTTGCGGCAGCAGTTGGTGAAGAAGGACCAGGGTGCTGCTCGCTCGGCGGCTGCAGCAAGTGCGCACA
CGATTCAGCTCAAGCGCGAGATCGCGTCGATGCAGATTGCAACGGCGGCGGTTGAAGCTGAACGTACCAAGTTCCAAGGTCAATTCACGCACACCAGCTC
CCTGCTTGAGACGGCACTGGACCAACGACAGGAGGACCAAGCCAAACTTAGCCGTCTAAGCGAGAAGCTGCGCACGTGCGAGAAAAAACACGAGGAGACC
GTCGAAGTAGTGAAAAATGAGGCGGCGGCAAATGTTCGCGCTACTCAAGAGGAGCGCCAGGCGTTGCGAGCTAGGGTGGAACAGCTAAGAGGCAAGTTGG
AGAGTGAGCGGAAGGAATGGCAGAATGTGCACCGCCCAATGGCGGACGAACTGCAAAAGTGTAAGACTCGACTGCAGCTGGTCGATAAGGAACTACAGGA
TGCACGGTACCGCGAACGATCTAGCTTCCAGTTGAAGGAGAAAATGGGAGCCGAGGTGACTATGTACAAGCGGAAGGTGGTAGACTTGTCGACAGCCCTG
CAGGAAGCGCTGCACGCTAAGAGTGAGCTAAAGGCTGAGCACTCGCTGATGATAAAGCACATGAAAGATAAGTGGCGGGAGGTTCTGCGCAACCATCAGC
ACTCGAAAGAGCAATTGTCCATGCTTCAGGAAGACTACAACGGGTTGTTCCGCTCGCGAACGTGTATAGAACAGCAGAATGAGCAGATCTACCAGGCCAT
GAAGCAAATGAAACTGCGGCATGAGCAGGCGATGAAGGGCAAAGAAGAGGAATGCTGGGAAATCGAGAAAAAACACAAGAAGATTAGCGCCACCTGTCCA
CAATGTTTAAAGACCCCTGAGCAGAAAAAGCAAGAAGAGGTGATTAAGATGGATGCAGTTCGTGAGCAAACCCGACTAGAAGTTACGAAGAACATGGAAC
TCGAGCGCTGGGATCGCTTTCAAGAAGTGAACTCAAAGTACTTGGATACGTGTCGACAACTCCAGATTGCTGTCGAGGAGTCCGAGGTGGTTCGAAGTAA
ATACAATACTGTGACAAAGCAACACGACGAGCTTCAAGAAGCAGAACAGAAGTTATCATGCATGCTAAAGGAAGCCCAAGTCAAGGTACGCGATGTGAGT
TCAAAGCGAGATGAGGAGGCACAACAAATGGAAGGGACTAAGAAAACGATGCAAGACCTGGTAGAAAACTTGACGAGCCTGACGACTGTGGTAAGTAGAT
AGTTGTCCTAAAGAGCGGGCTTGTAGATTGGTGGGGAAGAGCACGATGTCGGCCTGGATCTAAGTGCTACGTGTGTGAGCAGACCGCAGACCAGAGTAAA
AAGCTTCAAGAACTCGAAGCTGCTCGACTGGAAGAGGTCAGTGGAACTTTAGCTTTTTTAAGTGTGTTTGGCTGTGTGAAGGAGACCCTGAACCTTCTTC
CCTGTGTAGCATGAAACCTTGACGGAGCAGATTCGAAGCCTCGAAGCAGACAAAACCTCTATAGCCCAAGACCACGCGCAGCTTACGCGGAGATACGAGG
AGTTTGTCGCGCAGTACGAGTTGCTCAAGCAGGAAAAATCAAAGCATTGGAATGAAATTGTTGAGGCGCAGTTGAGTGCAAACCTACTGATCGAGGTGCG
ATTAAAGCTACTATCGTGGAAGACTGTTAGCGACAGTAACTCTAATTTCTTCGTTCATTTCCATGCAGGAACAGGCTCACACGATAGATGATCTGCTGCA
GGCGAAGGCTAACGAATCCCCGTCCAAGTCGAAATTGTCACCGAATCGCGTTGAATCACCCCTCTCACCCGAGGCGCTCACAAGCCTAGCCGATCGTGGC
GTCCCGCCTGCCGATCACGTTACCGGTAGTCTGGTTGCTGTCTTGCGTCAAGAATGCGAGGTGTTACAAGAAGAAGTGACCCGATTGAAGTCTGAGTCTC
GAGGAGACCGAGTTCTTTGGCACGGTGATATTGAGAAACGAGAGGGCGAACTCCGGCAGGAAATCAAAGCATTGCAGCTAGAGCGGCAGAAGTTGAAAAA
GCGTCTTGAGGAGCAAGCTCTTACAATTCACGAGCTGACACTTCAAGAGGAAGAAGACGACGGAGACGATGAGCAGAGCTACATATGTAGCAATGGGCAA
GTATCAGCTGACTTTGATCCGGGCGTGTCGTCCTGTGCGGATAGCTGTGCGTCGCCACCGAGTCGACCAGAAAATGATCGACGGGCACCTACTCAGGCAT
ACCGTTACTCATCTCGCCAACCAAGCGATGCATTCTGGCTGCCTCCCTCAAAGTCTTCTGGTCGTGATAGGAACTCCCCAAATCGACCGGACCGTAGTCC
TTTCGAAGTGAGCGCTTACGGTTTGCCTGATGCGAGAGCTCCAAATTGAACAGTTAACGATTTTGGTCTTTCATCGTGCACCTCAGTTGAGTTACCGAAC
AGCATTCTAGCAAATTCTTGGTTGCGGCGAAGGCTCTCATAATTCTTGCCTCCAGTACGCAATGCCAGTACATGTATGATGAACGTCCCCTTGAATGCTT
TCCGATTCACCTTTCGACTGATCCGCCGTGTGTTTATGGCGTTCGACGTAAATTGCTACTAGCAATCACTACTTTGACTGGACTACAGTAGCGCCACCCG
AGCACTTGTACATGTACCGGTACGTTTAACCCCACCGAAATGCAGTCAGGATACCGGTACCTGGTCGGCCGCCACTATTCCAGCTGTATTGTACGTCGTA
CATATTGTACATATTGTACATGTGTACCGTGGCTTGGAAATGCATCATAGCAGATTCTGGGGAAATCAACAGCCCCCAAGCAGAGTAGTTCGTGCCTCTT
TGCCGTTTGCACAGGTTGTCGACGCGACCAAAGACACCTTTGCCGAGGGTGCTTCGAACGCCGAGTCTATAATAATAGAAACGCGCTTTGGACATCTTTA
CATGGGCATCTTCGGCTGTGCTCGAGGAAACGCAAGAAAAGGAGCGGGTCCTGCGTGTTTCTGGCATTTAACGAGGTTGTCCCGGGCGGCAACAATTTAA
TCGCGCGAAACGGGGCATTTGCATCGATTTAAGGTGCAAGTTGTTGTCGATACAGCTTTTGACCATCTTGAGATCGCCCCGCTCCGTGGCTCACTGACAG
AACGATTGAGTGGGGAGGGGTGCGTCTCTCGGTGACGAGCGTCAACTGGAGGCCCCGGAATCGCAGTTGCGACCGATTAAAATACAACATTGGCTGAGCT
TGCCGCGGAGTGCGGCACACCGCACCCCAAGCTTTTGTGGTGGTGCGTTGATAGCACAATAGCAGTCTGGAGCTGCGATTGAGCGCTACAGTATAGTAAT
TGCGTCGCTATGTGCACGACGCCACGAGCACCACGATCTGCCCAAATGGGCAGCACTACACGTATTGATAGTTGTCGACCCGAAGTGGCGACCGTCTCCG
TGTGAATCGCAGGTAGAGGACCAATTCCCGGGGCGCGCCTTGAACCCGAGCTCTGTTTTACTTGGAGGATAGCCGTAGTGCGCGTTTCTAGTTGTCCGAA
TTACATACAGAGCTTGCGTGCAAGCCACCTCCCTCCTTGCTCACCATCGACGGCAAACACTGTGGTGGCGGCAATGAAGTGTCAAGTGAGAGCTTTCGGG
TCGGTAGCGCCCACTCTCCATTTTGCTTTTTGCAGTCCGCCTCCGAAGGTGTCTCGACCACTATGGACCGCTCACGAAAAGAACCCGGGCGTGGCAAGCC
TAAAGACGACTTGAAAATCACCCCAGCCAAAACGCAGGCACTCATTGACGTCTCCACGCCGTCGCCCAATGCCCCTCGCTTTGGTGACAAAACGACCCCA
ATAACGACGACAATGGTCAACATGAGCCAGAACCCACCGCTCCGAAAACCGGCGACGGCCAACTTCATGGATAGCAGCAAGTTCATGTCGATGAACGCAA
CCAGCACCCATGCGGTTGGCAACTGCAGGAACACCAACCGGCGCTCGCATCGTCGCCGCGCTAATGTGGACGCCATGATGCGTTCAAACATGGTTCGACA
AAGTTTGACACTGTCGACGTCGAGTGTCTCGTCGCACTCCAACGCCGCCCGGAAGAAATGCCGCATTGCCCCACCTGCCGGTAAGGACGACATGTACGGC
CCACCTCCTGGAAGTGATGTTGTGACCGTGCCGATCCCTGGCGACTGCAACTTCGAGCAGAAATACAACGTGGCCATGAGCATGGATGAGAAGGCGTACA
CGCCCATGGAGCAGCTGGAGGCGCTTCGTGATGCGATGGGGAACTTCACCGACAAGGATGGCTACATCGAGCGCGAAACCTTTTCGAATGCCTTCGAGGT
GGACGGCAACGATTTCGATGGGTATGCTACCAGCACCGGCACTATTGACGGAAATGCCATTCTGATCGACGCCGTGATGAAACTCGGAGTAAATGCCGAG
CAGAAGTTGCGATTCATCTTCGATACACTGGACCCAGACAACACCGGTTATGTGATTGAGGATCAAATCATTCAGCTACTGGAGTCGAACTTTTCCAGTG
CTCATATTGATGTGGTGGGCATGGAGTTGAAAGCAGTGGCCAAGCTCATGTTCCGCAAGGCACGAGTTCAAAATGACGCAATGACGTTTGAACAATTCTG
CGCGGTGTTCGAGCCGTACGTGACAGACTCTTACCACCTCGAGGAGGCCAAGCCCGTGTACTCGGCTCCGATTCGCCCCAAGAGCAAGTTCGGTCAATGG
TACAGTGACAACAAGCTGCGTGTCTGGTGGCTTCTGTTCTACGTCATCGTGAACAACATCGCCTTCTGGGTCAAATGGTTCATGTACGAGGTTGATCCTG
CCATCGGTTGGGGTCTTCGTATCGCCCGAGCCAATGCCCAGGTCGCCATGCTTAACTGCGTGTTCGTGCTGCTGCCCATGTGTCGCTCCATCACGCAGGT
CATGAAGCGCAGCAAGTTTTTGTGGCGCATCATTCCGTTCGACGATCACATTGCCTTCCACAAGATCTCGGGAAGTGTGTTGCTGATTGCCGGTCTCATT
CACACGATCGCTCATGTGTTTAACGAGATTTACCTGTACCTCATCGCCACGCCGGACGAGGTCAAGCGATCCATTTTCGTCACTCGCCACGTTTCGACGT
TTGTGAACGGTGAGCGACCTCCGTTCACCACTATGCTACAAGCGCTTCCAGTGTGGACTGGCGTGATTCTTCTGGTCATCACTTGTATCTCGTTCCCTCT
TGCTGCGATCCCGAAGTTCCGCCAGGGCAAGTTCAACCTTTTCTGGTACTCGCACATGCTCTTCGGACCATTTCTGGTTGTACTGGCATTCCATGGAGCC
ACATCGTGGCTTGCTCGTTGCTCAGCCTACATCTGGATCACACCTCCGTTCCTGATCTACCTGATTGAGCGTCGCTTCCGGTACGCCAAGATGTTTGCTG
CACCAGTCCGCATCATGGAGGCTGTGGAGCTGGATGGCACCGTTGCGCTGTTTATCGAAAAGCCCCGTCGGTTCGTATACAGACCCGGCATGTACTTGTA
CATCAACTGCCCTCAGATTTCATCCCATGAGTGGCACCCATTCACGATTTCATCGGCTCCGGGTGACAACTACATTAGCATCCACATGCGCGTCTGCGGT
GACTGGACGGATGCTATGGCTCGTGTGATTGCGGACTGCCACGCGTGCAACCTGCAGTACCCCGATGTGTATCTTGATGGGCCGGTTGGTGCTCCAACGC
AGGACTACCACCGCTACAAGACCGTCATTTGCATTGGCGGTGGCATCGGCGTCACCCCGTTCGCTTCGATTCTTAAGGATGTGGTTCATCTGTGGGAGGA
CAACCGTTGCTTGAATTGCAACCATGCTCGCCACCCGAGCTCTTTCCAGATCCAGAAGTTGTACTTCCACTGGGTGACCCGTGGACAGGAGTCTCTGAGT
TGGTTCGAGGGCACGATGAATCAGATCGCCGAGATGGATCGAGACAATGTGATTGAAACGCACCAATACTTGAGTACGGTTGTGCTCGGTGGCGAGGAAA
ACACGTCCCAGCTTAAGATGTTTCAGGAGTTCGTACACGAACAGACTGGCAAGGACATCGTTTCCGGGATGCACACGAAGCAGCTCACACACTTCGGCCG
CCCGGACTGGGACAAGATCTTCTCCGATGCTAGAGCCATGCACCCTGGCGAGGAAGTCGGTGTGTTCTGCTGTGGACCCCACGAGTTGGAGGAGGTGCTG
AACAACATGTGCAAGAGGTACTCGTCGTCGAGTGCTGACGGCACAATGTTTGACTTCCACTCGGAGAAGTTTGCGTAAGCGAATGCTACTTCAACTCTCC
CTCCACGCCGATCTGCTGAACGAAAGCAGGCGTACCGATGTTTGTATCGATGTCGTCGTCGTATCTTTTACATAGTTGCCGAATACATGTATCGTTGGTC
TAATCATTTTCTACCCCTTCACTGCAAACCAAGCCATGGTTTGACTGGTGTTTCGTTCGCAGCGTTTTAAGGGACAATGGACTGCCGGTGAGCATTAAGA
TATGACAGCTCGAGCTCAAACATGGAGTCCCAGAGCTTGCCGGTCAAGAACACGTGGCGAGTCACCGGGTCGTAGGCGATTCCGTTCATCACAGCGTCCG
TCTTATAAGGGGATACCTTCATTGCCTCGGAATGGATATTGGCTGCCATGTTGGGTATCCAATCCAAGTCGATCTGCTCTAGCACGTCCCCGGTCGCGAT
GTCAATGCGCAGAATGTGGGTTTCAAACCACACGTTGGCGAGCAGCTCCCCCTCTACGAACTCCAGCTCGTTCACATTGGCCACCGCCACGCCGTTCTTC
CGGACGGTGATGCTGTGGTGCAGCGAGAAGTCGTCGCGCGGGTCGAAGAAGAAGATGTTGGCCGAGCCGTCGCTGGCGATGAGGAACTCGCCGTCTGTCG
TGAGGCCCCAGCCCTCCTTGGTAGATGTCGTGAGGGGGAACCGACCGATCAGGTGGAAGTCGTGTCGGGACAGCACCAGCACCTGCTGCGCCTTGTACGT
CAGCGCGAACAGCTTGTCGCCCAGCACGGTCACCCCCTCGCCAAAGGTGGCATCGTCGAAGCGGAACTCCCGCAGGAGCGGCACGCTGTGCGATGCCCCC
TCCCTGAAGAAGCTTGGATGGAGGTCTGCCAGCTTGTACTCGCGGATGAAGGATGCCCCGTTGAGGCCCGTGGACTCGATGATGGCGCCGCCGTCGAACA
CGAGCCCTTCCGTGAAGGCGCTGACGTTGTGCGGGTGGATGGTCACGAGGCGCACAGCTGTGGGCGCGCCATCGCCAGTCGCGGTGGCGACACTGAACCA
GGCCAGGCTCGCAAGGAGGAGGAGCAGCAGCAGCGCGGGAACCATGGGGCGCGTCAAGCGAGCATCAGGGCGGAGGAGGCTGGGCATGAGCTGCAGACTG
AAAAGCTTATGGCGAAAGAGATGGACTCATAAACAGGGACAAAATAAGGCAAACAGCCTGCGTCATTGCATAAATTTGCTCATTTATCAGCGATTAGATA
TGGAATCCGGTATAAAATCAATTGGAGCTTGCCTGTTGACAACGAATGCACAGCAACTGGCTGGTCTCAAAGCAAAGTTTCCTGAAAACCAAACGCTTTT
GGCGTTTGCGATGCCTCTCAGTCAAATGAAGTCTCTTTTGTCGCCCCTCCTCTTCGTTAGCGCACGTTGTGCTCGTTGCACTCGATAGAAAAAGATCCAC
TGGCGCGTAGAGAGCAGAGCTCTCAAACCACTCGAGTCTCGAGTTGAGACTCCTGAGACTGCAACTGTTGGGCGGAACGTCGACTACGTGCTCACGAGGG
CATGCACTTAACAATGCGCTCAACAATTCAACAATCCCACGAGCCTGCCATGTGTACAGTATGGGTATGTAGGGCGGGCACCTGGTCCAGACAGCCTCAA
CCTAGGTGACCTGGGTCGAGCCTCGACTCGAGGCTGTCCCGACGGTTCGGGCAACAAGCACATCGCTGGGAGAATCCCCAACTTGGCGTTCCGCGCGGCG
GTCGTGGTCACGATCCAGCGCGAGCCTTGCTAACGCCGCAATCTCGCCGCGGGGGTCCCCCTTTCACCGATGAAGTGCTGGCTAATGCGCTTGCAACGAC
CAAATTTCGTGCCGTCGACCATCAGTTACTATTATACTTGTAATACTTCGAAGTATTAGTAGACTTTCCACTCTGTCAACAATATGGAGAAATCGAGCAG
GAATTGTCGCCAAGTACTCCTCAGTCAGAAATCGACAGCAGCACTACAGTACTGGAATACTATTACCGGTAGTGCATGCATTAATAAATCGTGTGCATTG
GCTTCGCTGGAGGTTCGACGTAATGAATATCTGGTAAAACTGGCAGTACACTGTAGCCACATGTGTATTTAGAGATTCGCCGCTGCGAGCGACGCCATAC
CGACGGAATACACGAGCCCGGCGGATTTGGCGCGTCGTTCGCTTGGACGCCGCGGATCAGGAGCAAGCAACCTGGTCCGGCATGCGAAACCGGCGAAGTC
ATGGAGCGGCGATCGTGAAATCTGTTGTGACCACTGGGCACTGGCCAGTGAAACAACCTCGACTTGAATACACCCTGCTTCGATGCCAACTATTATAAAA
GGCGGCGGAGGATGTTCGAGCAAAGTGTGTGTGAGTTGACCTTGGGTCGTCAACGTTTGTTTGTACACATGGCAAAGCCGAAAGATATCCCCGAGCCCGC
CGCAGAGTCGGTTCAGCGCGAGCCAGAAAACAGCCGTCCCATACAAACTCGAAGATGTTCGAGTTCGGTGGGCTGCATTTTACTGACGTGTCATCCGCGG
GCACGGACGGGTCGCGGCACCGACCAGGTGGGCGCTGGGGCACTTCGCCATTTGCCTCGTTGCAACGCCGTCGGCAGTGCCACTTGCCTGTTTCCCAGGC
ACCGCGTTTCTAGAGACGCCGCGTTACGCTCCGAGGCCAGTCGCGGATTCCCTTCTCCACGGACCATCGTCGTGACCTCGACACTTCGCTTTCTACGGCT
TCGCAAGGACACGAGGCGTCTCGATGCAGCGCGACCGCCAGAACCGCTTCCGCAATGGGAATGCCACGCCCAAGCGCCAGCCCGCGGACGAGCTCAAGAT
CACGCCGGGCCAGAACCACCAGCCCTTCGTGGACATCTCGACGCCGTCGCCCAACTCACGCAAGCTAGGAGGTCGCACCGCCAGCCGGAAGGGTAGCATG
AAGAAGAGCAAGCGCGCACCGGCCCCGCCCCCACCGCCGCCACCGCCGCAGCACATGACCAACCACCCGGCCATGATGTCCTCTTTCCACAGCACAGCCC
AGTCCAACTTCATGGACAGCAGCCAGTTCATCAACATGAACTCCACCACCGCACACATGATCGGCCGCGGCCCGCCCAAGATGAGCGCCAACTGCAAGAG
CAGCGGCAACAACCGTCGCCGCCCCAACGTTCAGGCCATGCTGGGCGCCTCCATGGTGCGTGAGAGTCTAGCGCGCGCATCCAACCTGTCGTCGCTCGCC
GGGTCCAAATTCAACATAATGGGAGACTCGAGGTACGGCCCGCAGCCGGGCACCGATGTTGTGTCGGTGCCAGTCCTCGGCGACTGTAACTTCGAGCAAA
AGTACAACGTGGCCATGAGCATGGACGAACATGCCATTCACAACAACGACCCTGCATACACCCCCATGGAGAAGCTACACGCTCTGCGCGATGTGATGAG
TAGCATCACCA