Description :
From Genome Similarity Track
Location :
Scaffold_380:2875- 4450
Transcript NameFunction/comments
Hyaar_Emoy2813953Amino Acid/Auxin Permease (AAAP) Family

Sequence
1575 bases(100 bases per row)
CTTCTCCTCAGTCTTGAATTTACCATCCCTTCCACATTCATCCTTGCCACCACACCTTAGCACTCGCTGTCCACACCATGCCGCACAAAGCCATTGTAAC
CGCAGAAGACTTTAAAGTGGCTTTCAACCTCTTTTGCTGTGTGTATGGCATCGGAACGCTTGGGATGCCCGGTAACTTCTCACGTGCCGGTCCTCTACTT
GCTGTAGTCGCCATGGTCTTCATGGCTTTTGCCAACGTGTACGGGGCAGTGGCGATCTGTCGTGTGATGCTGATGGCTCCTCGCTCAGTCAAGACGTACG
GCGATCTTGGCGAATGGTGTATGGGTACACCCGGTCGCTACTTGTCCGTCATCTCGCAGATGGCCAATTGTCTTCTAGTGCCGTGCGTGTTCCTCGTATT
GGGTGGAACACTCTTGGATGGACTTTTCCCGAATGCCTTTAGTGCGACCACGTGGATCATTCTCATGGCTCTCTCGTGTGCTCCTATGTGTCTCGTCCCA
ACGCTGAAGGAAGGAGCAGCAGCCGCTTTCGCCGGTTGTATGGGCACCATCATTGCTGACGTGATCGGCGTCGGCATCGTGCTGCACAGCATGCGAGGCC
ACCCGAGCATCCCCAAGCCCGACCTCAACTTCAAGCAAGTGGCTGGTACTTTCGGCAACTTGGCTCTGGCCTATGGCGCTGGGATCGTCATTCCGTCGCT
CCAGCGTCAGCATAGCGACCCCACGCGCATGCCTTGGGTCGTCGGGATCACAATGTTGTTCATCTCGGTCCTCTTTCTCATCCTGGCCACCTCGGCGTAT
TCAGCTGTTGGATGCCAGATCTCGGGCAACCTCCTGTACGCGATCTACCCTGACGAGACGGGCTTGACGACGCTCGGCTTTGCGTCAGACTGGGGCATGG
TCGTCCTTGCCTACCTATTCATGCAGCTGCACATTACGATCGCTTTTTCTGTGATCCTTAACCCAGCCTTTTACATTGCCGAGCGCATTGTACTCGGCAT
GCATAAAGCTGTCGCCTCGGATGTCGAAAACAATTTGCTCAGCTACGTTGAAGTGTCGACACCTGACGTTGGCGAGCGCTCCGAGAAACATTCACCCACG
TCCTGCGTCTCAAAACGCCGCTCGATCCTTTCGGTGGCCGACAATGAAAATACTCAGTTCGATGACCCGGCGGCTGAGACTTCCGAGTACAGTGGAGCAA
ATGTCGTGAAATACATTGCACTGCGCCTTGCAATAATCACGAGCCTTGTGGTCGCGTCAGTGCTCCTAAAGGACCACTTCCACGACTTGGCAGATTTCAC
TGGAGCGTCTTGCATCACAGTCAACTCTATCGTCCTGCCCATCGTTTTTTTGCTGAAGAAGAGATGGAACATTTTACCAATGTGGGAGAAGATCCCAGCG
CTAGTCGTGGTCATAGCATGTTTCAGCCTGGGATGCTACGTGACATATATATCAGGCAAAAACCTGTTTGTTCCCAGCCACGACGACACAGCCTTCCCAT
TCTGTGCGCCAGAGTTTAAAAATACTGTGTACTACAACTACACAGCTGCACACGAGGGCTAGACAGAAGTAAAGC