Description :
From Genome Similarity Track
Location :
Scaffold_336:28741- 30852
Transcript NameFunction/comments
Phymu_g8771hypothetical protein
Phymu_g8772hypothetical protein PHYSODRAFT_485789

Sequence
2111 bases(100 bases per row)
GGGGCCGGGTCTTGGATTGCTGGCGTCTGGAGAAGccgctggtggcgctggatgatGGAGTTGATCTCTCCTTTGTTGTGAAGGCCTTGCAAGTGCTTCA
GGACGGCACTGGATCCACCCGAGGTGATCTGGTGCTCGTCCTGCAAGAAGCCAAGCACTGCTTTCTCTGCTTGCTTCCccagctcaagaacgcgGTCCCG
GTAGTCGGCAGCGCCTGGGTCAAGAGTGAAGCCGTCCAtcaggaagagcttcatgaaggcAACCAAGATCTTCGCTTTCGaacgctgctgtttctgtGCC
TGCGTCATCCATCGAGGTTCCTGCGCGTACCACGCGAACCAAGTTGCATGAAGGTGGGTCAGCGATCccctgcgctgcttcttcttcggagTACTAacgg
cttctgcttcttgttcacaGCTTCGTTTGTTTGTTGCTTGCACAGGATCGTTGTTTTGCTTAGCCTCGAGTGCATCCATGCGCGCATTTTGTCGCTTGAT
GTGCTCGATAAAGTGTCTAATcacagcagcttgatggTCGATGATCTTCTGTTCCTGGCTTGGTTCTCTTGGTTCGTTGTCGTGCCTGGTGGTATGTTTA
TCGGTTGGTTCTCTCTGTTGATAGGGCGTTGGATCACGCGCAAGGTGCGAAGACCaagcaagcagctcagccTCCGAGCACTTGGCATGGCGAACAGCAA
CCTCAACACGCGTGATGATCGGGCTTTTAGGATTCAAGGCCTTGAGCAGCGGGAAGTGGCGTACGACACGTGCGGTAAGCacatccagcaccttcttATT
TACGTTGTAGGTTTCCGTTTCGAGCGTGTAGCAGACGAGAAGAGGAGGCACTGGACTTCAGCAATCGAGTCCAGTGTAAGCGCGTCGAAGCTTGACAGGT
CTTGGAGCAGCACGGCATCCTTCGGTTTGTATCCGCTGAGCACCTTCGCGATCTTGTGATCTTctttgctggtgttgaagatATAGTTAAACCCCTTGTT
CGTCGTGCTCATATTCCTGGACCCTCGGTCGAAGATCTAGCGCGCGGTCATCTCGTCACAGCCGTTCGCGTGTTGCGCCCCGCCGCGTCGAAACGAATGC
GAAGTCAAAGCGGCCTCAACTCCAGCCAACGGAACGACGCGGTCCAGCACGCGGTTGACGTGCGCGTAAATCGTGGGAGCTGTGTCAGCACGCGGCGGCG
CAGCAGGGGCAGCGAGACCAGGGGCGACCGGAGGCGAGGTCAGGAGCTCAATCAGCGGGACGTCGGGTGACAGCGTGACAGCGGTGGGGGTGGCTTGGTC
GGGGAGGTTGCCGATGAGCACAGGGCGCGGCGCAGCTTGGACCATCAAGGCTAGAGCTATTGCGAGCACGGGGCAGGTTGCGAAGTCGGTGTCTGGGAAG
AGCGATAGCCCTTGCTCCTCCGACGTCTTGACGCGTACCAGCcgcaggaagaggacgtTCGACGCGTCGACGGagatgttcttcttgtggatCATCGCCA
GATCCGATGCGCGGCCAAACAGGTACCAGAGGAGGCATAGCagagcagcatcttgatAGTCACTTTCCGAACATGCATAAGTATTCAAATATAGCAACAT
TTTTTTTGAAGTCGGCCTTTGTGCATGGAGTTGCTTTTGATACGAGACCACCACAATCCCTCTTCATACAGAAGTTGTCTAGTGTCTTCCCCATTTTGAG
CAACTTAGCTTCAAGTGAAGCTCGGTGCTTAGGGAACTGGTCGAGTAGCCAAAGCTTGGCCTGCCGATAATACTGCATCGCAGTGTTGCGAGCTAACGGC
TTACCTTTTTTGCCTTCATTAAAGGCAAGATACATACCAAACTTATCCATCACATATACAGAGCTTTTACCGCTTTCGTCACTATCAATGCATTTTCTTA
CGTACTCTTCCTCAATTTCCTCTTCCTTTAGGAACTTACCGAacgctgcaacagcagtTGCCTTGGCACGCAAGGTGTTGCCAGGCTGCAAGTCGTCAAG
GCCCATGGCGTTGGTCCGATAAATGCAAAATATGCAAGTGATACGCCAATGACTTGAGTTTTGAATGGTCATACATATATTTTGCGAGTTGATCGGACTT
GATACGTCCGA