Description :
From Genome Similarity Track
Location :
Scaffold_10:287382- 288798
Transcript NameFunction/comments
Phypa_INRA-310PPTG_06667metalloprotease family M14B
Phypa_INRA-310PPTG_06668hypothetical protein

Sequence
1416 bases(100 bases per row)
ACCTCGAAGAAATGGGACGATGTTGGTGTCAAAGTTTAATCGTTTATTACGGTCTCACTGCTCACGTTAAGGCGTTAGATATCGAGCGTAAGAAACCAGT
AACACTCGACCAATCCATCGCTGAAGCACCATCTCCAACGAGTCGAAGTAGTCAAGTACAAATCAGTGAGGCACTGCGAGTGGACGTGGAAGATGAAGAG
AGTCGACTTGCAAGGGACCTCCTACTAGACTGCGAAGCCGCGATCTCTGCTTTGTTCGCATCCTCAGGTGTTAATGAAGACAACGGCATGGATTCGGATC
TTTCAGGTGCCGAGGATGAACCCATTCCACCGAGTCCATCAGGTGCTCCACAAATTGATACTGAACAGAAGAACTTACAAGATACAGTCGAAGTTAATGA
TGTTGAGGCGTCTTCTAGTACTCAAGAAGACGTATCCGCGTTGGATAACTCTGGAGACCAAACTGAAAAGAAATCGGAAAAGAAGAAGCGAGGATCAAAA
TTGAAATCAGTGGTCAGTCAAACGATGAAGAAAGCCAAGAAGAAGAAGAAGCATAAGGATAAACCGGAGCTAAAAAATACCTACTCAACATCAACACCAA
CGCAATCGAAACCTGATGATACATTAACTTTTACTCCCGAACTCGAGCTTTCAACTCCAGATGCTGATACAAACTCTAAGCCGCTAACAAAAAGAACCAT
GAGTGCCGCTCGGAAGAGTAAGAGTGTACGCCCTAAAAGCTCGATCGAGACCCCTAAAAGCGTCTCCAGCGCGATCCTCCAAGCCACCAAGAACGTGGAA
TTGCGAGCGAATTCTCGACTGTGTCCACTACCGACGCATCCAAACATTCCATTGGTGCTGCCAAGTGTCGTAGATAGCAGCCGTGTGGTCCCACGTATCC
TCCGAACTGCACCAGTCTGCGATCCAGACATTGAAGATAAATCTAGAATTCGCTCAGAACTCCCCGCTCTGCAACTTTCCGGTCGAGATGAAGACCAACG
GCGACATTCTCTACGACGAAGGTCCCGACGACAGGAGAATGACATTAAATCTGACGATTCCGACACTTTTCCTGTTCCAGAATCATACGGCTCAAGTAAA
CTCCTCAACTTAATCACGTAGATACTGTAAAAATAGAGCACCCCGTAATTGTTGTTGGAAGAACTCTATTTTTGCCCTAATCCGACGCTAACAAACCCGT
CATACTGACGAGTTGGCGCTGCAGCTCCTTGATTCCGAACCCTTCCTTCACACTCGTCACCTGGATAATAGGGTTCATACTCTACCACAGTAACTGCAAG
TCAAACAAAATGTCCACAATATACAAAAGTCTCCATCTTACCATACGTTCGGCGTTGAGTGCCACCTCCTGCGCCTTGTGAATCTGCCTCTCCAGCTCGC
TGCGTGTCACTGCATC