Description :
From Genome Similarity Track
Location :
Scaffold_31:287281- 292641
Transcript NameFunction/comments
Phyci_573350hypothetical protein
Phyci_453799Hypothetical protein
Phyci_221264PREDICTED: dysferlin-interacting protein 1-like
Phyci_453805conserved hypothetical protein
Phyci_27231conserved hypothetical protein

Sequence
5360 bases(100 bases per row)
ACGCGCACTGCTGCGTCATCCTGCTCGACTCGCACCGGCGAGCAGAGGAGCAGCAGGGGACATCCAAGAGTGGCGAAACGGTCAAGGCAGGCACCAGTCC
CCACGTCGACGACATCCATACCAACCTTCGTCCAGCGTCGATTAAAGAGAACTCAATCGCTCCAGCCAGCACGACAAACAGCATCAACAGCTCCCGCGCG
AATGAATCGGTATAGACATAGCCAACATGGGCTGCTAGAACTGCATGTACCTCGGCAGACAAGTGAGACTTTCAACTACGATTCGCCTGCTTCAACTTGA
AAAATGTTCCTATTTTGTAAAATCCGCCAATCAAACGTTATGCAAACATAGGGGCAGTTTACAATTAGGTATCTTGACAAGATGGCGGAGGCTGAGACGC
TGGCGGCCGTGAAGGCTGGCGACCTGGTCAAGCTGCAGCAGCTGCTGGATAGCGGCGTGAACCTGGACACCAAGGACGAGGACGAGCGCACGCCGCTGCA
TTGGGCCTGCGCCACCGGCCGCCTGGACGTCGCCGAGTTCCTCCTCGAGCACGCGAAAGCCGCTGTGAACGTGCAGGACGACGCTGGGTGGACGCCACTC
ATGAGTGCTGCTTCTGCAGGCCACGGGGATGTCGTGGGGCTGCTTCTGAGCAAGTGAGGGAATACCAGTAGTGGAGTGTGCAGCAGAGGAAGGAATTGCT
CTCTAACCGTGGGGTCGTCAATTGGTACTTTTGAATGCCACCCCTGTGTACAGGGGTGCAGATGCGAACCTCGCGAATGAGAATGGGCAGATTCCGCTGC
ACTACCACAGAGGTGGGTGGCTAGATGTCGGGTGTTGTGTGCAATAAGGTGAGTTTAACCAGTGGTGTTAATTGACGGGTGGGGAACAGGACGCCAAGAG
ATCGCCGAGTTGCTGCTGGACTACACGCGGGACGTCAACCAAGCGGTGCGATCGGGTTTCGAGGCGGTGGTTGACGTTGTTGCTGTAGCAGTACTTATTT
GAGGTTTTTCGTGCGATGTGGTTTTGGGTGTTGGTGCTGCAGGACAATACTGGGAGTACGCCGCTGATGCGTGCTCTGGGCGGTAAACCCAGCCCAGGTT
CGTTGATTTTCAGGTTGCTCTCAAACATCACTCCCGCTGACTATATTATTGGTGTTTCTGCTCTTGTTATGGACTTTCTCGTTGTATAGTGATCATTGCT
CTGTTGTTTGACCACGGCGCGAAAGTGAACACGCGTGACGTTGGAGGCAACACCCCGTTGCACTTGGCTATCAGCGAGGGATACGAGGATATCGCGCGAT
TCTTGTTGGAGAATGGGGCAAACCCGAATGCGAAGAACAACGATGAGGAGCGCTGCGTGGATTTGGCGAAGCCTGCATTTCGTGCAGAAATCCAAATGCT
GATGTCCAAGAAGAAGGGTGGCAATCATCCTTGAGGTGAAATCGATCCGTAAAGTTCAGCAGCCAATGACGATGGAAAGCAATACTGGGGTTTATCTATT
GTGTGCATGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNGTGAAATCGATCCGTAAAGTTCAGCAGCCAATGACGATGGAAAGCAATACTGGGGTTTATCTATTGTGTGCATGTTATTTATGTATTGT
GTGCATGTTTATTCTTCATGCTCAGCGGCTCAGCGATATCTTTCAGCTTAAAAGGTCACAACTCGAAGTCTCGTTTCCTTAGTTCTGACCATCGTGGCCC
CGCAAGTTTTAGTCATCGTCTGATCCACTGAGGTCCAGGTCCGGGATGTTGACCAAAATGAGGATGGAGGCATGGCAGTAGATTCTCTTCCACGCATTTT
CGATGGTCTCGTCCCAATCGGCTCCGCAAGTAAGACGCATGGCCTGGATAAGTGAGTCGCCGAGCGGGTCGAAATCGTCTGGCTTCACTCCGATCTTAAG
ATGTACAAGCGCCAGGTTCATCACCTTCTGGACGAGGTCCTCCGACGACAAGAGAGATTTCATGCCGCTGCTGATATGCACGATCACGCGGCTTTGGATC
TGGACTGATGCTTGGAAAAGAGGTTTCATGTGTGGATAGTTCTCGAAGAGATACTTGTAAAAGTTCTCATAGAGAAGCCCGATCTTGGTACCGGAGCCAA
CTGCGTGGTGTGCATCCGTGTGGATGTTTTCCTTGAAGACTCGTTCCCAGTGTTCGAAAGCTATAAGTCGGTCGTCGTTATCGGACGGTTCAGTGATCAC
GAAATGCGGCAAGTAGCGCTTGATGATACGGCAGTAGTGCTTGGAAAACTTGGGGCGGCTTGACGTGCTGCGATGGGCGCCGAAGCTTGCACCGACGCCC
ATTCTCGTTTGTTGTGTTGTCCTCAAGGATGCCGTTGCACAAAGAATTGACTTGTGATTAGTGAATTCGATGTAAGTTTAGGCGCTCTGGTGGAATGGCT
ACAAAGAAAATGGTGTAGCATTAATACAGCGCCGGCAACAATAGCGCTTATGCAATGGGCATAAGAAATCGACGACGTGATCTAAAATTTCAGCAACCTA
AAATACTTATTTCCCTCATGCAGTCATAGTATTCGTCTAATCAGTGCTGTGATGTTGATGGTCTCGTCCTTGAAGCTCTACTTGCTGAGTCATCATATTT
TGGCTGACAGCATTCCTGCCTCATTCTGAAGGACGTGCTTGATAAATATAAATGTACTGATGTGGAGGGACATCAGCGATGGAATCTAGCATCATCATTG
GCAACCTTCAAATATCAGGTCATTGAACCAAAAACCACACCATGTGCTGCACCCCGCACTTCAACGCCGCAACGCCAACGCAACTTCAAGATAAGGTAAC
AAGGAAGTACTTCCAATGGCGCTGGTTTCTATCAGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNCTTCCAGAGCTCTCCGTGATTCGTATTCGGGCGAGTAGTAGGTCGAGCATGCTTGTCCGTATTAAGATGGGTCACTACCGGGTCTGCTATCTT
GCATCGTTTGTTGTCCGATTTCGTAGCAGCTTCAAAAGAAGCATGATCATCGTTCTTCTTCAACTTGTTGGCAGCGTTAGCTTTTGCGATGTTGACAATC
GCAGCAGCCAGGTCGAGTTGCTCATTGGCTTCAGCAGCCGACATCTTGGCACTGGCTGCCGTCAAAGCAGCGCGACTTTTCTGGAATGGATACTAGTGTA
GCAACCAAAATCATCAACACACAAGTCAGTCACGAAGCAAACCACAGATAACAAAACTGACTCCGTCCGTACCTTGGATCGATTCACCACGAACACGTAC
GTGGCACAAAGGTCGGGCTCGAACTTCTTCGCCAGCGGGTCCGTCGTACGATGACGGTAACCCGGGAACAGGCGGATATTAAACTTCCGGCGCTCCTTGA
GCACGAAGCCCGCGGCCTTCGCCTGCTCCTCGATGAACCAGTTGGAGTACGGCGGCCTCGTCTTGAGCGACACGTGCGCTTCGCCATGGACCGTTAGTCG
GTCCCGCGCGCTCTCGAAGAAGTTGAGCAGCAGCGCACGGTTGATGTGCACACGTTGCTGGCCGCTGTGCGGGAAGTTGAAGACGATGTACTGGAAGAAG
TCGGGCACAGTCTTCATGCCCGCGCCCGTCTTGACCTGCTGCGGCAACTCAAGCAGCTTGGTGGCGTCCACGTCGTGCAACACAAGGCCGTGCGCCGACC
GCACGGCGGCGATGCATTCCTGCGCGTTGGGGTACTTGCTGCGCACTTGGCTCTCCGAGTCGAACGAGGTGGCCAGCACGCCTCGGCCGGTGCCGCGGTG
CTTGACTAGGCCGCGCGAGAAGGAGAAATCGCCGTCTCCGAGCACCAACACGTCGTCTTC