Description :
From Genome Similarity Track
Location :
contig_11:287275- 288554
Transcript NameFunction/comments
g3085.t1RAW39894.1 hypothetical protein PC110_g3867 [Phytophthora cactorum

Sequence
1279 bases(100 bases per row)
CTACAGCAAGTGCGACTTCATCAACGACTGGTACTTGCGGTACAGGTACACAGCTCCTGCAGCCAGACCAATGAACAGCAGAGCGAAGGGCGTCTTCCAG
CCGCCGCTCGCGATGTCCGGATTCTCCTCCAGCTGCTTGGTGATCTTCTCGTTCACCTCGTCGCCCAGCACCTTCTTGGTGTTCTCCAGCGACGAGTCGA
TGCCCTTGCGTACCTTTGCCTCGATCTCGCGCACGCGGCGCTCGTTCTCGCCCTCTTGCTTCTTGAGTTTCGCCACGGTATTCTCTGTCTTCTCCTTCAG
ATCGGAGAAGCGGTGTTCAGCGTCGATACGGAAGTTCGACAGCTCCTTCTGCAGCACGGCGATCAGACAGTCCGTGCCGCAGTTCGGCGAGTCCATCCAC
TTCTTGTAGTCCTTGGACACCGAGTTCATCACCATCTCTGAGTCCACGGCGCCCGTCGTAGCGTCCGTGAAGTCTGTGTACGCGTCGAAGCGGATGATGT
CGTGGTTGTCGGCCAGCGCACCCGTGGACGCCGTGATGCCGATCGTAGACTCGCGTAGCCAGTCCTCGCTGAACGGCAGCGTCATCTCGTGGCAGGCCAC
CCACAGACCAGAGGCGTGCTCGTCCACCTCCACCACGAGGCGCGTCTTATCGATCTTGACCTTGATGCGCGAGATGCTGTGCACGGGGTCGAAGTTGGCG
CTCTGCTCATGGTAGCGCACGGCGGCGTTGCATCCCGCGCGCTTGTCGTGGTACATTTGGTCATACGTCTTGGTGCCGTCGTTCACGAACACGCTCACGT
CCTTGTGGCCACCCTTGTGCTCAGGGTTGTTGAATGTGTCGATAACTACGCCGATACCCTTGTACTTGTCCGTGAAACCGTGGTTCACGCCGGGCGTGAA
CACCTTCTGGCCGGTGATCCAGAAACCGATGCCGTCGCCGAACCAGCGCTTGCCCTGGCCGGACACGCGGAACGTCAGAATGGCCGACAGCTCGTCGCGT
CCCACAGGGCTCTTCTGCCACAGGTGGCCACGCTTGCTCTGGCGGTCGGTGGTGAGGCGGATGAAGTGCTTTTTCACGTCCGCGTTGCCGCCGTGTGACC
ACGTGGTGTTGACCATGCGACGGCCCTCGGTGTCCACGACCTCGAATGGCGGCTTGAACGACACGTCGTCCATCTTGGCGGCGGTAGCGGGGCAGGACAG
CAGCGCCATGCACGCGCATAGCAGCAGCAGCAGCAGGCCGCGGGTCTTCATGGCGTCGGGCTGACGATCAAAGCGAGGA