Description :
From Genome Similarity Track
Location :
Scaffold_140:2872- 4082
Sequence
1210 bases(100 bases per row)
CCACGGAGTCGATGATCGCCCCGATGGCTGCGTTTCAAACGTGCAAAGTGATGAACTGGCACAACTGGAACGACTTCAAGTACGCATGCAACTGGAACCA
CGGCGCTAACGGGAACAACATGTTCTTCATGCGCTGGGACGGGACGTTCGTCTACGAGTGCCGTTGCGACAATGGGCTTGGAAGTTACGACCCATGGGGG
TCCCACTGGACGTGGTCCAAGACGGACGGCATCGCGTGCTACACGCGAGACGGCAAGAAATGGTACGAGATTGAGCACCAGTTCGGCTCTGTCACGTGCC
GACGCGATCAGAAAAATTGCGACACGAAGAATGGGTACTGCGCGTCCTTTTAGACGTCGTCCGTCATCGAGCGCGACGGGTGTGATTCTCTGGCATTTAG
CTCCATCCCCAGCTCTTCCGCTGACAAGCTCAAGGCTGAAAGAATCCATTAAATCCAATTTTGCACCACAGTATATCCGAGCAGGTGTATAAAAAAACGT
GTTGTCTGGTAAATAACATAACTCGAGTGTTTTGAACATGGCTAAGATGTGGATGCCGAGTTTCCGATTTTATATTAGCATGTGAATTTTGAGCCCTGGA
GACCTTCAAGGGAGCCCCGCGTCAGCAGCGCAGGTCTCTGAGAAAAGTAAGACAGTGACTGTGTTAGAGAGGATACGCAAATTGCAAAAGCTAACGGTAT
TTTAATTCAACTGTGGCATAAGTAGATGGCAGAGCCATTGTAATTTCTCATGATTTTATGCTAGTACAATTTGCAAAACCTCTATAAGTTATCACCGTGT
CAAGGCGAGTCGTGCCGTCAGCAGGATGCTCTGAATCAGAGCCTCTAATTAAAAAGCTGGGAGATGTGCTGAAAAGCTGATGCCTGATACGTGACGTGAC
TTGTCCACCAAGGCGATTCGTCTTCACTAAAGTGGTGCAACGGTTGCTGATTTACAATGATTTACAATTTGCGTTCATTTTGCATTGCACTGTACAGTAT
GAGCGCACCCAAGATTGGGAAAACCAAAGTATCACATCTTAGCGTATGCATAAGAGAAAACTATTAATTTGCTCTCAGTCTAAACTATTAGTAGCATGGG
AGGGCTAAGAAATAGTTCAATGATTATCTAATTGCAATGGCAACCACATTTTAACCTGTTTGAGACTCTCCCAATTCACCTATATTTCTAAGATGTACTG
ATTTGCGATA