Description :
From Genome Similarity Track
Location :
Scaffold_2186:2871- 3920
Transcript NameFunction/comments
Phyag_g12170ATP-binding Cassette (ABC) Superfamily

Sequence
1049 bases(100 bases per row)
ATGTGGCGGCCAAGTACGAAGAGTTCATTAACCCGTGCGTACTCAGTTGGAGCGACCTCAGCTATGCTGTGCcgggcaagaagacggccaagaacccgta
cggcaagaagatcatccTCGACAAAGTGAGCGGCCGCAGTGCTCCCGGAGAGCTCACGGCCATTATGGGCCCGTCCGGTTCGGGTAAAACCACGCTCGTG
GACTTGTTGGCCGATCGTATCAGCTCCGGACTAGTGACTGGAACCATCGAGCTAAACGGCATCGACCGCGTGACCAAGACGTTCCGGGCCGTGACGAGCT
ACGTGGCCCAAGAAGATACGTTGCTAGGGTCCTTCACCGTAGTGGAGACCATGAAGATGGCGGCCAGACTGAGTCTGCCGAACAGTGTGGTCATGACGGA
TATCCACTCGAGAGTGGAGAGTGTAATGGACGCCATGGGGCTCGGCGCCTGCAGGAATACACTGGTGGGCGACATCTTCCGTAAAGGGCTTTCAGGCGGT
CAAAAGCGGCGACTTAGTATCgccatcgagctgctgtcgaacCCGAGCATCTTGATTCTGGACGAACCGACAAGTGGTCTCGACTCCAGCTCCGCACACA
ACGTCATGAAGTATATTTTGAAGCTTTGCGGTGAAGGCAAGAACGTCTTGTGTACGATCCACCAGCCGTCGTCACTAGTTTACGACATGTTCACGAACGT
GATCGTGCTGTCCCAAGGACAGACCGTGTACTGCGGATCACGGTCCAACATGATCCCGCACTTCGCGTCCATCGGATTCACTTGCCCCAAATACATGAAC
CCGGCCGAATACTTCGTTAACCTGGTGAACACGGACTTCGAAGACCACGTCGACGTCACCAAGATCGTGTACTCCTACGCCCAATGcaacgtcaagaagc
agctttTGGACCAGCTCTCGGCTGACcggacgacgctgcagacgttgCCGGATATTGAACTGAGACCGTCGTCCGCAATGCGGCAGTTCACTGTGTTGAT
GTACCGCAACACGCTCAACAACATCCGCAACCCTGGCATCTACTGGATC