Description :
From Genome Similarity Track
Location :
Scaffold_155:28709- 31127
Transcript NameFunction/comments
Phyag_g2834myosin-like protein

Sequence
2418 bases(100 bases per row)
AAGGAGGAGCACATGATCGCGGTGGGGGCGCGTTGCTACATTCCAGACGAAGAGGCCGCGTGGCTGCCTGTGTATGTCGAAGATGTGGACGAGCAAAAGG
GACTCGTGACGGTAAGGATCCAACGCTCTCGCAAGGACCAACAGGACGTGGAATCTgccgaccacgacgacgcagacagATCGGGGGAGAGTAGAGTGGT
GGCAATTGACGTCGGATTCCCACTGCAGAACGCACAGCTTTCGCGTTATGACGAGGGGCTGAACAACATGATTGACCTGAACCATTTACACGAAGCTGCG
ATCCTGCGGAACCTCAAGAAACGCTTTCGGGCTCGGATGCCGTACACTTACACGGGGGATATCTGTCTCGCAGTAAACCCTTACCAGTGGCTGGATGAGT
TGTATACTCCTGGACTTCACAAGAAATATTTGCAGTCTCGGAAACGACAAGATCTACCGCCTCATGTGTACGCAGTGTCCGTGGCGGCTTTTAGGCATAT
GTGCGATAATGGTAGCAACCAGAGTATCCTGGTAAGCGGCGAATCTGGCGCAGGGAAAACGGAGACCACCAAAATTCTAATGGATAATCTGGCTACCATT
GCGCCTGCACCGAGCAATGCTGTGAGTGAACAGGAGAGCAACATCACCTCACGTATTATCGAGGTCAATCCGCTGCTCGAAAGTTTTGGTAATGCGAAAA
CTACTCGCAACGACAACTCGAGTCGATTCGGCAAGTTCACACAGCTACAGTTTGACAAGACTCACGCACTTTGTGGAGCCCAGTGCGAGACGTATTTACT
GGAGAAGACAAGAGTTATCTCCCATGAACGCGGTGAGCGCAACTATCACATTTTCTACCAGCTTTTGCACGGCACCACACCGGAGGAGCGAGACGCGTTG
GGACTCGGCGATGAATGTCCGAGGTTTGCGTATCTGGAAGAAAAGGAGCCTCAGATGGAGACACGGCCTGGGAGAAAGCCAAAGCTGAgcgcgccaccac
ctccaaagCCAGCGGCTGTGATCGAAGCCGAGAATGCCAAAGACCGAGCACTCTTTGCCAAGACAAAGCAGGCGCTGTCACTACTTGGACTTGGCCCCGA
ACAGCAAAATGATTTGTTCCAGGTATTGTCAGGCATTCTGCACTTAGGTGAGGCTCAGTTTACCAAGAACCCCGACAACGACGAAGCCTGCGACCTGGAG
AAGGACTCGGTAACGTATTCGAGCACATTGTTAGGCTTGAATCCCGATACGATGGCGAAAGCTCTGACTCATCGAACTATGAAGGCTGCTGGGGAGGTTT
ACCTTGTACCGCTTACGGTTGAGCAGGCTCAGTCAGGACGTGACGCACTTGCGAAGGCCATTTACGCGAGCATTTTCGACTGGTTGGTGGCTGGAATCAA
CGCCAGTCTTGGTGCCCCACCACGACGCACTGCAAACACGATCGGTGTGCTGGACATCTTCGGCTTTGAGAGTTTTGAGCACAACTctttcgagcagctc
tgcaTCAATTACGCCAACGAGAAGCTACAACAGAAGTTTACTCAGGACGTGTTCAGGTCTGTGCAGGAAGAATATGAGCGCGAGAAGATCACGTGGGCCC
ACATTGCGTACGCTGACAACAGCGAGACTCTGTCACTCATTGAAGGTCGTATGGgtgtgttggcgctgctgaacgaggagaTCGTACGCCCGAAAGGTAA
CGAGGAAGGATTTGTGAGCAAGCTTTCAGGTGCCTAcctcaagcagaagaagctcattGAGTTCCCACGGATCTCCAAGACGCAATTCGCTATCCACCAC
TATGCCGGAACTGTCAAGTATGAGGCTACAGGAttcctggagaagcacaaggaCGCTCTGCTTTCAGACTTGTCGGACTTGATGTGTGGCAGCAATGAAG
GGTTCCCGCAGATGCTCTTTAAGGTGAAGGCCGAaattgaagctgcagctgctgctgagcttaAGCGCTCGACCTCAGGTCGGAAAGTTGGgggaggtgg
agctggagcggacAAAACGGTGGGCATGCAATTCAAGCAGTCGCTCAACTCGCTCATGACCAACATTAACGAGACGAACGTTAACTACATCCGGTGTATC
AAACCGAACAGTGCCAAGAGCTCAACGCTACTTGAGGACAAGATGGTCGCTAATCAGTTGCGTTGTGCCGGTGTCATCGAAGCCATTTGCATCGCACGCG
CGGGGTACCCGAACCGATTGCTGCATGCAGAGTTTGCAGAGCAGTTCGACATCTTCCTTAACGAGAAGGAACAGAAccagctgaaggaggagcCAGAGAA
GTATGGTATTCCTCACTGCAACGTCTTGGTCAAGCGGTTCAAGCTCGAGGCTCCCGAGGAGTTCCAAATGGGTGTGACGAAGATCTACCTGCAGAAGGGT
GTGCTCGAAATGCTCGAG