Description :
From Genome Similarity Track
Location :
Scaffold_15:28706- 30392
Transcript NameFunction/comments
Physo_131236hypothetical protein

Sequence
1686 bases(100 bases per row)
AGATTCGCCCGAGGTGCCGGCTTCGGACCCTGTCCCGAGCTTGGTCGGCACCACGGATGAGTCCGCCGGGGGTGCGACGGCCGGGTCGTACGTGTCGAAG
AACAGGTCGTCGGCGTCTTCGTCGTCGACGCTGGACTCGGGCGCAGGGGCGCACATGCCGCTCTCCGGTCCGCTGGCGTTGTCCGCCCGGGCCGCCGGAA
CCGCTGTGTCAGGTGGGGAGCTTGGCTTCTACCTGACGCGGCAGGTGATCCCGGAGCGCAAGGTGGTGCCCGACCAGGACGACGTCGACATGGCGGATGC
TGAAGTGGCAGCCAACGTGAGGTCTGCACGGACATCTTCGTCCAGGAATGCGAGGAAGCACCGCGACTCCGGCCGGAGTTCTTCGTCCAGCGAGTCTGAC
TCGGACAGTGACTGGGGTCGTCGCAGCAGCCGCCACCGACGCTCGTCTAAGCGGTCTTCGCGGAGGCGCTCCCCATCGCGTCGCTCAAGCCGCTCGGGGC
ACTCGGGGAAGTCCGGCCGGGCTGGGTCGTCGATCTCGTCCGGCGCCGCTGAGGCTGCCGTGAGCGCCCTGCACCAGGTGCAGATGCTCGGCAACAACTT
GGAGTCGATGCGCGAAGAGCTGGCGGCGAAGGAGAAGGCCGCCCAGGATGTTGAGGTCCGGCGTGCTCTGACCGAGGCAGAGCGGCGTATCCGCGAAGCC
GAGGAGCGCGCTCGCGAGACCGAGAGGCGTTTCCAAGCTCCCACCCAGGAAGCCCCAGGCATGTCGCCCACGGAGGTTGCGGCCGCCATCCAGGCAGCCA
GCCTCCAGGCCGTGAGTGCCGAGCGTGAGCGCGTGGTGGCCGCCGCTATGCAGTGGGTGCAGCAGCAGCAGACCGAAGCCGACGCCAAGCGCGAGGTCGA
GCGTGCCGCCTGGGCCGCGCAGGCCCAGCGCAACCTGGAAGAGGGCCAAGCGGCGATGAAGCAGGAGCTCAAGAACATGCGTGCGACGTCCAAGAACATG
CAAGTGTTCCAGAACGAGCAGATACGCAACCTTCTTGCGACCGTCGCCGGAGTGGTGTATGTCATGGATGTCTGGATCGCGGGCGACTTCAAACGCGCAC
CACTCCCAAATGTACTGAGAGAAAATAATCAATATCAATACCCTACCACACAATAGGCTTCCGGTCAAGTCCCAGGCGGCGCTATTCACTCCGCCCGAGA
TGTAATCGATAATATGAAATGCAGGGCCTCGCTCGGGGCGAGAATACGGCTGCAACTAGGAAATGAAATAGGCGGATCACCCTGAGACGCCTGTGCGCCC
CAGCCCCCTTACCTAAGTTGGCGTACTTACTTCAGGGAGAGATCCAACCACGGTCGTACCTAGCCGCGGTGCCCTGTCGTCCTGCGCTTCCTGCTCTTCC
TGGCGGCTTGCGGGTTTCAGGGGAAAACGAACTCTGTTTATCTTTTACTCTGTGGCTATCTTCCTGCAACTTAGACATGCATTTTGCTTTTCACTTGATT
TCACTATACTTCGGTTGACGTCGACATCCCGGCCAAGCCAAAATCCACTGTAGAGTCGTGGGTACAAATCACCTCCTTCAGCGTTCCACGGAATCTTTGC
CCATCCTTGGTCGGTCTGCCTGGTCGGTCAAAAACATCTTGACTTGAGTATACCTTGATCGTATCTCCCAGACTTACACCCGACCA