Description :
From Genome Similarity Track
Location :
scaffold_1413:2870- 4450
Transcript NameFunction/comments
Pl_100719hypothetical protein PHYSODRAFT_547637

Sequence
1580 bases(100 bases per row)
TACCCAGTGGGATGGCGAACATCCTGCAGGAATCAGATTCCTGCTGTGCGGCTCGTAGCTCACCAAATGGGGTCCAAGCACTCGCGCCTCTCACCGCGAC
AGCATACGGATGACAAGGGTCGCCCGACAGCTGCCAGACGGCATGGCAACCAGCAGCAGGATGACGATATCTCGGTGGCGGCGCGCGCCGAGTTCACGGT
GGACGACATCCGCAGCCCGGAGAACACGCTGCGCGCACAGAGGCTCCGGGACAGCGACAACGACCGCTTCTGCAAGTACCGTAACTACTTCAAAAACCAT
CACATGTCGTTGGCTCGAGAGGTGGGTCGCAAGACTAGCAAGAACAAGGCGGAACTGCTGCTCTGGGTCGAGGAAGTTGTGGGGCCACTAGAGGCCGGCG
ACAGGTTCACTAAGGACGAGATCTTGGAAATCGCCATGGTGTCGGCAGCCCTCACCGAGTACGGTGAGTCCGTGCTCTCCGAAATGTACGATCGAGGTGA
GCTGGACGCGCTGCCTAACATACCACTACATACACACAATCTGCGCATGCCAGCCAAACAGCAGGCGTGTCGAGACAGCTCGGACGCCGCGAACAAAGAC
AAGCTGGAGGCGGCACACTATATTGGACTAGAGGTGATGCTACGACTCAACGAGCGACTACCAGTGGAGCAGCGCATGGGTGAGGAGCTGCGTGAAATCC
TCAATCATCCGAGCAATCTCCGCCTCATGCTGGCAACGAGCAATCAGGTTCTGCACAAGAAGGTGGACGCGTTGTTGATCAATGCGAAGGACATACTCCC
ATCGTCTGAGACACACACCAAGCCACAGCGCAAGATCTCGGCCCGAGAGTATGACCGACTGGTCCAGATTGCGAAGCACGCTCAGGATGAAGGTTTTCAA
GATGCCATGATCGCAGCCAATGGCTACTATTTATACGTAAGCTTGCGCGAACAGTTCAATCGAATGAATATTGGTGATCGACCCAGGCTGTGGGATGCTG
AAAAAGACAAACATAATCTCAGACAACCGCCTCGATCTAGGTTCCGATCCCCATCAACAGTGCCACATCAACCAAGAACTCCTCCATCACCAGAAAAGAA
AAAAGACCCAGAACGCAGAATGGTTCAAGACCCAGCATCGACATCCAACGCATCTCCCGAGAAGAAACACCGAAGCCCCTTTTCTCGCTTGGCAGCTAAA
TTATTCCACTCACATAGCAAGAAGAAGCGTGCAGCTACCACGCGACCAGCTTCGTCTGTAGCAGTGGAGAATCCTCCCATCGACACTAAAATAACGGTAA
ACCGAGCAGGCACAAAAGATGGGAAGAAGAAGGCTTTGGCCAAGACGAAAGCAAAACGCCCAGTAGGAGATGTCAAGAAGCCAAATCAAAAGCCTCGACC
TCGCACAAGAAAGCCAACAAAACCACTGGTTCACCGTTCCAACCAAGACTCTAGTTCAGGTGAGCACTCGTCAGATGACAGCGATTATGTTAATGTGGAT
TCCGACGATGGCAAGAAAGTTCACCGAGTGCTTCACGTTGGTCCTCGTGGAGGCAAGTATTACATCAACGCGACCGGCAA